View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11833_low_8 (Length: 441)

Name: NF11833_low_8
Description: NF11833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11833_low_8
NF11833_low_8
[»] chr5 (76 HSPs)
chr5 (3-163)||(1912121-1912287)
chr5 (311-374)||(2217693-2217756)
chr5 (311-374)||(6118330-6118393)
chr5 (311-374)||(15635477-15635540)
chr5 (311-374)||(18633796-18633859)
chr5 (311-374)||(35165995-35166058)
chr5 (161-226)||(1912035-1912100)
chr5 (311-374)||(294028-294091)
chr5 (311-374)||(5614365-5614428)
chr5 (311-374)||(16616463-16616526)
chr5 (311-374)||(27850212-27850275)
chr5 (311-374)||(29151618-29151681)
chr5 (311-374)||(29172625-29172688)
chr5 (311-374)||(29692928-29692991)
chr5 (311-374)||(35167001-35167064)
chr5 (311-374)||(36577821-36577884)
chr5 (311-374)||(38962929-38962992)
chr5 (311-374)||(42207342-42207405)
chr5 (311-371)||(25779000-25779060)
chr5 (311-374)||(21050675-21050738)
chr5 (311-374)||(23382145-23382208)
chr5 (311-374)||(28550927-28550990)
chr5 (311-374)||(29875501-29875564)
chr5 (311-374)||(30888262-30888325)
chr5 (311-374)||(31037497-31037560)
chr5 (311-374)||(38496521-38496584)
chr5 (311-371)||(37090580-37090640)
chr5 (311-374)||(4203554-4203617)
chr5 (311-374)||(5950274-5950337)
chr5 (311-374)||(7075797-7075860)
chr5 (311-374)||(16038575-16038638)
chr5 (311-374)||(18046187-18046250)
chr5 (313-374)||(21125109-21125170)
chr5 (311-374)||(10409033-10409095)
chr5 (311-374)||(30800687-30800750)
chr5 (311-370)||(33335864-33335923)
chr5 (311-374)||(39379330-39379393)
chr5 (311-373)||(38786259-38786321)
chr5 (312-372)||(3850465-3850525)
chr5 (312-372)||(28863672-28863732)
chr5 (311-372)||(14318239-14318300)
chr5 (312-372)||(10743893-10743953)
chr5 (312-371)||(22551155-22551214)
chr5 (311-374)||(24782112-24782175)
chr5 (311-374)||(40029240-40029303)
chr5 (318-360)||(20690840-20690882)
chr5 (312-374)||(27916564-27916626)
chr5 (315-372)||(3850662-3850719)
chr5 (312-360)||(13990708-13990756)
chr5 (320-360)||(17070646-17070686)
chr5 (316-372)||(26071397-26071453)
chr5 (318-373)||(37271542-37271597)
chr5 (318-372)||(4736379-4736433)
chr5 (322-372)||(5904210-5904260)
chr5 (318-372)||(10830638-10830692)
chr5 (318-360)||(20661057-20661099)
chr5 (317-370)||(25561814-25561868)
chr5 (326-372)||(31602264-31602310)
chr5 (318-372)||(40038604-40038658)
chr5 (312-372)||(9179760-9179820)
chr5 (318-374)||(11935805-11935861)
chr5 (312-360)||(29366799-29366847)
chr5 (328-372)||(32108926-32108970)
chr5 (312-372)||(34125408-34125467)
chr5 (312-371)||(18286530-18286589)
chr5 (318-373)||(19685125-19685180)
chr5 (318-373)||(24443489-24443544)
chr5 (328-371)||(28107918-28107961)
chr5 (318-372)||(1286884-1286938)
chr5 (318-360)||(2636778-2636820)
chr5 (322-372)||(9588449-9588499)
chr5 (326-372)||(28213490-28213536)
chr5 (318-372)||(35609382-35609436)
chr5 (311-360)||(9532291-9532340)
chr5 (327-372)||(32888798-32888843)
chr5 (312-348)||(26133275-26133311)
[»] scaffold0370 (1 HSPs)
scaffold0370 (311-374)||(125-188)
[»] chr8 (75 HSPs)
chr8 (311-374)||(4375791-4375854)
chr8 (311-374)||(6146784-6146847)
chr8 (311-374)||(19494220-19494283)
chr8 (311-374)||(38930403-38930466)
chr8 (311-374)||(40493054-40493117)
chr8 (312-374)||(4017005-4017067)
chr8 (311-373)||(21509796-21509858)
chr8 (311-374)||(1525911-1525974)
chr8 (311-374)||(6146616-6146679)
chr8 (311-374)||(22917763-22917826)
chr8 (311-374)||(33636424-33636487)
chr8 (311-374)||(1163013-1163076)
chr8 (311-374)||(1408190-1408253)
chr8 (311-374)||(8094581-8094644)
chr8 (311-374)||(14495236-14495299)
chr8 (311-374)||(16643879-16643942)
chr8 (311-374)||(24187668-24187731)
chr8 (311-374)||(25131210-25131273)
chr8 (311-374)||(28398875-28398938)
chr8 (312-374)||(21125857-21125919)
chr8 (311-374)||(10776334-10776397)
chr8 (315-374)||(16789209-16789268)
chr8 (311-366)||(22650568-22650623)
chr8 (311-374)||(32040209-32040272)
chr8 (311-374)||(40066595-40066658)
chr8 (311-369)||(1685216-1685274)
chr8 (312-372)||(15719758-15719818)
chr8 (312-372)||(33526155-33526215)
chr8 (311-374)||(7272522-7272585)
chr8 (311-366)||(24954855-24954910)
chr8 (311-372)||(14488816-14488877)
chr8 (312-372)||(14238852-14238912)
chr8 (312-372)||(19963099-19963159)
chr8 (311-374)||(27341426-27341489)
chr8 (318-372)||(28497363-28497417)
chr8 (318-372)||(35115536-35115590)
chr8 (311-360)||(18549305-18549354)
chr8 (311-372)||(30337023-30337084)
chr8 (312-372)||(10755369-10755429)
chr8 (312-372)||(29487949-29488009)
chr8 (312-360)||(32418529-32418577)
chr8 (312-360)||(40844386-40844434)
chr8 (312-372)||(43477351-43477411)
chr8 (312-372)||(43727268-43727328)
chr8 (318-372)||(8298696-8298750)
chr8 (311-372)||(14496914-14496975)
chr8 (318-371)||(20277801-20277854)
chr8 (318-371)||(21064428-21064481)
chr8 (312-372)||(7578369-7578429)
chr8 (312-372)||(35143684-35143743)
chr8 (316-371)||(23939654-23939709)
chr8 (311-374)||(29158456-29158519)
chr8 (318-372)||(6469503-6469557)
chr8 (318-372)||(7326195-7326249)
chr8 (318-372)||(7420339-7420393)
chr8 (318-372)||(29992138-29992192)
chr8 (318-372)||(42429957-42430011)
chr8 (323-360)||(2811555-2811592)
chr8 (323-372)||(15931106-15931155)
chr8 (311-360)||(32195381-32195430)
chr8 (318-370)||(1778673-1778725)
chr8 (324-372)||(9175209-9175257)
chr8 (318-370)||(13154995-13155047)
chr8 (318-370)||(24814814-24814866)
chr8 (318-373)||(11976572-11976627)
chr8 (316-371)||(17074006-17074061)
chr8 (316-371)||(17574209-17574264)
chr8 (318-360)||(4473813-4473855)
chr8 (318-360)||(10540558-10540600)
chr8 (318-372)||(10873118-10873172)
chr8 (318-372)||(13232307-13232361)
chr8 (318-360)||(13779384-13779426)
chr8 (328-370)||(44998104-44998146)
chr8 (318-371)||(42132973-42133026)
chr8 (318-354)||(5357618-5357654)
[»] chr7 (73 HSPs)
chr7 (311-374)||(1007065-1007128)
chr7 (311-374)||(6108533-6108596)
chr7 (311-374)||(7432053-7432116)
chr7 (311-374)||(39719455-39719518)
chr7 (311-374)||(45021597-45021660)
chr7 (311-374)||(1559542-1559605)
chr7 (311-374)||(12894238-12894301)
chr7 (311-374)||(19783916-19783979)
chr7 (311-374)||(21223508-21223571)
chr7 (311-374)||(30709425-30709488)
chr7 (311-374)||(31732287-31732350)
chr7 (311-374)||(35015055-35015118)
chr7 (311-374)||(45073478-45073541)
chr7 (311-374)||(46304218-46304281)
chr7 (312-374)||(48358913-48358975)
chr7 (311-372)||(28911679-28911740)
chr7 (311-374)||(488814-488877)
chr7 (311-374)||(5308523-5308586)
chr7 (311-374)||(14738700-14738763)
chr7 (311-374)||(17999560-17999623)
chr7 (311-374)||(19561249-19561312)
chr7 (311-374)||(21554589-21554652)
chr7 (311-374)||(22871162-22871225)
chr7 (311-374)||(30352662-30352725)
chr7 (311-374)||(37372741-37372804)
chr7 (311-374)||(44344627-44344690)
chr7 (311-374)||(44403088-44403151)
chr7 (312-374)||(18022468-18022530)
chr7 (312-374)||(18311682-18311744)
chr7 (311-374)||(25547327-25547390)
chr7 (311-374)||(39833005-39833068)
chr7 (311-374)||(44508820-44508883)
chr7 (312-374)||(10358105-10358167)
chr7 (312-370)||(31310519-31310577)
chr7 (311-370)||(35210352-35210411)
chr7 (311-372)||(19757851-19757912)
chr7 (318-371)||(35665984-35666037)
chr7 (312-372)||(20388376-20388436)
chr7 (318-372)||(9659464-9659518)
chr7 (312-372)||(13769874-13769933)
chr7 (312-360)||(23816885-23816933)
chr7 (316-360)||(35104125-35104169)
chr7 (312-360)||(37952902-37952950)
chr7 (312-372)||(46648516-46648575)
chr7 (325-372)||(19465733-19465780)
chr7 (312-371)||(45671314-45671373)
chr7 (318-360)||(2945694-2945736)
chr7 (318-372)||(5354955-5355009)
chr7 (313-355)||(17854314-17854356)
chr7 (318-360)||(35838033-35838075)
chr7 (318-372)||(39520507-39520561)
chr7 (318-372)||(46759810-46759864)
chr7 (329-374)||(1974162-1974207)
chr7 (318-371)||(3975677-3975730)
chr7 (318-371)||(16940871-16940924)
chr7 (328-372)||(11767036-11767080)
chr7 (312-372)||(24953989-24954049)
chr7 (328-372)||(30223580-30223624)
chr7 (318-357)||(6892003-6892042)
chr7 (321-360)||(34877885-34877924)
chr7 (325-372)||(44841471-44841518)
chr7 (322-360)||(6846969-6847007)
chr7 (318-372)||(27458508-27458562)
chr7 (330-372)||(35470117-35470159)
chr7 (329-371)||(38486631-38486673)
chr7 (318-372)||(41054013-41054067)
chr7 (318-372)||(45228693-45228747)
chr7 (312-372)||(41365054-41365112)
chr7 (316-360)||(3808028-3808072)
chr7 (328-372)||(6589080-6589124)
chr7 (327-371)||(28262916-28262960)
chr7 (332-372)||(43300730-43300770)
chr7 (318-374)||(46829145-46829201)
[»] chr6 (54 HSPs)
chr6 (311-374)||(14655606-14655669)
chr6 (311-374)||(17321390-17321453)
chr6 (311-374)||(17321523-17321586)
chr6 (311-374)||(24273939-24274002)
chr6 (311-374)||(33801579-33801642)
chr6 (311-374)||(8680877-8680940)
chr6 (311-374)||(31166971-31167034)
chr6 (311-374)||(31398377-31398440)
chr6 (311-374)||(34582631-34582694)
chr6 (313-374)||(15962131-15962192)
chr6 (311-371)||(543562-543622)
chr6 (311-374)||(777875-777939)
chr6 (311-371)||(24692820-24692880)
chr6 (311-370)||(494602-494661)
chr6 (311-374)||(2616071-2616134)
chr6 (311-374)||(7155898-7155961)
chr6 (311-374)||(11129302-11129365)
chr6 (311-374)||(15076040-15076103)
chr6 (311-374)||(15116773-15116836)
chr6 (311-374)||(19296242-19296305)
chr6 (311-374)||(30928881-30928944)
chr6 (312-374)||(7324029-7324091)
chr6 (311-374)||(10091135-10091198)
chr6 (311-374)||(32885774-32885837)
chr6 (312-374)||(317911-317973)
chr6 (312-374)||(26375794-26375856)
chr6 (312-372)||(19275879-19275939)
chr6 (312-372)||(21995167-21995227)
chr6 (311-374)||(1890161-1890224)
chr6 (311-374)||(3356337-3356400)
chr6 (312-374)||(6468508-6468570)
chr6 (312-374)||(6591277-6591339)
chr6 (312-372)||(14428751-14428811)
chr6 (311-374)||(5286687-5286753)
chr6 (311-359)||(17772014-17772062)
chr6 (318-372)||(24901347-24901401)
chr6 (312-372)||(2373331-2373391)
chr6 (312-372)||(12612196-12612256)
chr6 (328-372)||(13617648-13617692)
chr6 (312-372)||(33131626-33131686)
chr6 (318-360)||(12298927-12298969)
chr6 (318-372)||(19320876-19320930)
chr6 (318-372)||(31198724-31198778)
chr6 (318-355)||(13268218-13268255)
chr6 (318-373)||(3968754-3968809)
chr6 (318-369)||(25121337-25121388)
chr6 (328-371)||(31185753-31185796)
chr6 (318-372)||(15722719-15722773)
chr6 (318-360)||(25137102-25137144)
chr6 (327-372)||(23628999-23629044)
chr6 (316-372)||(1214801-1214857)
chr6 (312-372)||(9896477-9896537)
chr6 (332-372)||(23770360-23770400)
chr6 (312-360)||(34990165-34990213)
[»] chr4 (81 HSPs)
chr4 (311-374)||(50714401-50714464)
chr4 (311-374)||(4279170-4279233)
chr4 (311-374)||(6827709-6827772)
chr4 (311-374)||(13479371-13479434)
chr4 (311-374)||(34355065-34355128)
chr4 (311-374)||(34361981-34362044)
chr4 (311-374)||(35415401-35415464)
chr4 (311-374)||(36702101-36702164)
chr4 (311-374)||(41346054-41346117)
chr4 (311-374)||(41620091-41620154)
chr4 (311-374)||(55482306-55482369)
chr4 (311-374)||(24474798-24474861)
chr4 (311-374)||(27427944-27428007)
chr4 (311-374)||(41920920-41920983)
chr4 (311-374)||(51708863-51708926)
chr4 (311-374)||(52017705-52017768)
chr4 (312-374)||(53717009-53717071)
chr4 (312-374)||(55072492-55072554)
chr4 (313-366)||(13064260-13064313)
chr4 (311-374)||(123730-123793)
chr4 (311-374)||(18135951-18136014)
chr4 (311-374)||(27008243-27008306)
chr4 (311-374)||(29463749-29463812)
chr4 (311-370)||(38054646-38054705)
chr4 (311-374)||(49123159-49123222)
chr4 (313-374)||(16712529-16712590)
chr4 (311-374)||(3178784-3178847)
chr4 (311-370)||(5063105-5063164)
chr4 (311-366)||(9446168-9446223)
chr4 (311-374)||(18830946-18831009)
chr4 (311-374)||(22584446-22584509)
chr4 (311-374)||(32208642-32208705)
chr4 (311-374)||(35763790-35763853)
chr4 (312-372)||(22099749-22099809)
chr4 (316-372)||(45505730-45505786)
chr4 (312-372)||(45593328-45593387)
chr4 (311-374)||(46087860-46087921)
chr4 (330-374)||(50822134-50822178)
chr4 (312-372)||(51545808-51545868)
chr4 (318-372)||(11692870-11692924)
chr4 (318-371)||(7642491-7642544)
chr4 (312-372)||(2180411-2180471)
chr4 (311-371)||(18205256-18205316)
chr4 (312-360)||(32365196-32365244)
chr4 (323-367)||(52429825-52429869)
chr4 (318-372)||(5797657-5797711)
chr4 (318-360)||(5827764-5827806)
chr4 (311-374)||(9289368-9289427)
chr4 (318-372)||(13530488-13530542)
chr4 (318-372)||(25424149-25424203)
chr4 (318-371)||(25358407-25358460)
chr4 (311-360)||(29420387-29420436)
chr4 (318-371)||(51738309-51738362)
chr4 (318-373)||(47135887-47135942)
chr4 (318-360)||(4211610-4211652)
chr4 (318-372)||(12791811-12791865)
chr4 (318-372)||(24774264-24774318)
chr4 (318-372)||(36050395-36050449)
chr4 (318-372)||(54208662-54208716)
chr4 (312-357)||(11285605-11285650)
chr4 (318-371)||(14488025-14488078)
chr4 (323-372)||(41439902-41439951)
chr4 (316-348)||(14791727-14791759)
chr4 (318-370)||(29380717-29380769)
chr4 (312-360)||(43368566-43368614)
chr4 (312-372)||(52441862-52441922)
chr4 (312-360)||(8191238-8191288)
chr4 (318-373)||(42848227-42848282)
chr4 (328-370)||(2034693-2034735)
chr4 (313-371)||(28449065-28449123)
chr4 (326-372)||(35119380-35119426)
chr4 (318-360)||(46115628-46115670)
chr4 (318-360)||(46128762-46128804)
chr4 (318-360)||(46292441-46292483)
chr4 (318-372)||(47022942-47022996)
chr4 (322-359)||(12152343-12152380)
chr4 (318-371)||(50754094-50754146)
chr4 (321-373)||(19321682-19321734)
chr4 (318-374)||(19903370-19903426)
chr4 (318-370)||(52543568-52543620)
chr4 (326-370)||(54903315-54903359)
[»] chr3 (101 HSPs)
chr3 (311-374)||(13584105-13584168)
chr3 (311-374)||(19656739-19656802)
chr3 (311-374)||(22156031-22156094)
chr3 (311-374)||(37506968-37507031)
chr3 (311-374)||(275543-275606)
chr3 (311-374)||(3151947-3152010)
chr3 (311-374)||(4950203-4950266)
chr3 (311-374)||(8510316-8510379)
chr3 (311-374)||(10977079-10977142)
chr3 (311-374)||(20757500-20757563)
chr3 (311-374)||(20907293-20907356)
chr3 (311-374)||(21159652-21159715)
chr3 (311-374)||(39072049-39072112)
chr3 (311-374)||(39288735-39288798)
chr3 (311-374)||(39436944-39437007)
chr3 (312-374)||(5345525-5345587)
chr3 (311-373)||(47901901-47901963)
chr3 (311-374)||(10778568-10778631)
chr3 (311-374)||(12673841-12673904)
chr3 (311-374)||(14633723-14633786)
chr3 (311-374)||(16123242-16123305)
chr3 (311-374)||(26799990-26800053)
chr3 (311-374)||(28427444-28427507)
chr3 (311-374)||(29955400-29955463)
chr3 (311-374)||(30004554-30004617)
chr3 (311-374)||(34238699-34238762)
chr3 (311-370)||(40169493-40169552)
chr3 (311-374)||(45161213-45161276)
chr3 (311-374)||(45320816-45320879)
chr3 (312-374)||(29446057-29446119)
chr3 (311-374)||(51834778-51834841)
chr3 (312-374)||(18175889-18175951)
chr3 (313-371)||(20612738-20612796)
chr3 (311-371)||(3830232-3830292)
chr3 (312-372)||(4513459-4513519)
chr3 (311-370)||(7518287-7518346)
chr3 (311-374)||(25710708-25710771)
chr3 (311-374)||(30130258-30130321)
chr3 (311-374)||(31869793-31869856)
chr3 (323-374)||(49670674-49670725)
chr3 (311-360)||(46186620-46186669)
chr3 (318-374)||(7957062-7957118)
chr3 (311-374)||(9863239-9863303)
chr3 (312-360)||(15016597-15016645)
chr3 (312-360)||(51759922-51759970)
chr3 (311-374)||(50261777-50261839)
chr3 (318-372)||(40277931-40277985)
chr3 (313-371)||(50196401-50196459)
chr3 (312-360)||(4814751-4814799)
chr3 (312-372)||(30268585-30268645)
chr3 (312-360)||(51500536-51500584)
chr3 (312-359)||(28942627-28942674)
chr3 (318-372)||(4034826-4034880)
chr3 (318-372)||(9261991-9262045)
chr3 (320-374)||(30426121-30426175)
chr3 (318-360)||(36673072-36673114)
chr3 (329-371)||(40979479-40979521)
chr3 (311-373)||(45521650-45521712)
chr3 (312-374)||(53701461-53701523)
chr3 (312-360)||(15286354-15286402)
chr3 (312-372)||(30552246-30552306)
chr3 (318-370)||(52342421-52342473)
chr3 (321-372)||(36732750-36732801)
chr3 (313-372)||(45313700-45313759)
chr3 (326-372)||(2486739-2486785)
chr3 (318-372)||(9596932-9596986)
chr3 (322-372)||(20405060-20405110)
chr3 (328-374)||(30034307-30034353)
chr3 (325-371)||(35533393-35533439)
chr3 (318-360)||(50009029-50009071)
chr3 (322-372)||(53113496-53113546)
chr3 (318-359)||(8555158-8555199)
chr3 (318-371)||(9603738-9603791)
chr3 (321-370)||(28418653-28418702)
chr3 (316-372)||(16679801-16679857)
chr3 (328-372)||(35177374-35177418)
chr3 (328-372)||(35565627-35565671)
chr3 (332-372)||(43440614-43440654)
chr3 (318-373)||(12741016-12741071)
chr3 (318-373)||(22008726-22008781)
chr3 (318-373)||(22016244-22016299)
chr3 (321-372)||(35407551-35407602)
chr3 (318-373)||(45002130-45002185)
chr3 (312-371)||(46901203-46901261)
chr3 (318-360)||(1721196-1721238)
chr3 (318-360)||(20644614-20644656)
chr3 (318-372)||(25609968-25610022)
chr3 (318-372)||(31480337-31480391)
chr3 (318-372)||(45005995-45006049)
chr3 (322-372)||(47114651-47114701)
chr3 (322-372)||(54767284-54767334)
chr3 (328-373)||(8940361-8940406)
chr3 (326-359)||(29678237-29678270)
chr3 (319-372)||(38232445-38232498)
chr3 (318-371)||(39132745-39132798)
chr3 (328-372)||(11463318-11463362)
chr3 (320-360)||(14772323-14772363)
chr3 (318-354)||(27681426-27681462)
chr3 (332-372)||(40370425-40370465)
chr3 (329-373)||(49323982-49324026)
chr3 (323-371)||(51058703-51058751)
[»] chr2 (74 HSPs)
chr2 (311-374)||(19183884-19183947)
chr2 (311-374)||(23989937-23990000)
chr2 (311-374)||(26814064-26814127)
chr2 (311-374)||(38980089-38980152)
chr2 (311-374)||(3838099-3838162)
chr2 (311-374)||(5790734-5790797)
chr2 (311-374)||(24483632-24483695)
chr2 (311-374)||(37271938-37272001)
chr2 (311-374)||(40302077-40302140)
chr2 (312-374)||(17541612-17541674)
chr2 (312-374)||(38731929-38731991)
chr2 (311-371)||(16899996-16900056)
chr2 (311-371)||(16993387-16993447)
chr2 (311-371)||(43710480-43710540)
chr2 (311-374)||(7814442-7814505)
chr2 (311-374)||(7814575-7814638)
chr2 (311-374)||(8046430-8046493)
chr2 (311-374)||(12835427-12835490)
chr2 (311-374)||(26238912-26238975)
chr2 (311-374)||(41693838-41693901)
chr2 (311-370)||(41791119-41791178)
chr2 (311-374)||(43789027-43789090)
chr2 (311-374)||(44985722-44985785)
chr2 (311-371)||(14392969-14393029)
chr2 (311-374)||(20658160-20658223)
chr2 (311-374)||(22881806-22881869)
chr2 (311-374)||(33732960-33733023)
chr2 (311-374)||(40786561-40786624)
chr2 (312-374)||(24483500-24483562)
chr2 (311-371)||(26707972-26708032)
chr2 (311-374)||(1497780-1497843)
chr2 (311-370)||(10665084-10665143)
chr2 (311-374)||(11713680-11713743)
chr2 (311-374)||(25954262-25954325)
chr2 (311-374)||(31225817-31225879)
chr2 (311-374)||(44073642-44073705)
chr2 (311-360)||(43592146-43592195)
chr2 (311-372)||(43597339-43597400)
chr2 (311-374)||(17912550-17912614)
chr2 (312-372)||(45442415-45442475)
chr2 (311-372)||(32691413-32691474)
chr2 (312-360)||(31326101-31326149)
chr2 (311-373)||(19831632-19831694)
chr2 (318-372)||(20939162-20939216)
chr2 (318-372)||(23732166-23732220)
chr2 (318-371)||(1138091-1138144)
chr2 (318-371)||(25750804-25750857)
chr2 (312-360)||(44993909-44993957)
chr2 (311-374)||(29865348-29865411)
chr2 (318-372)||(4424004-4424058)
chr2 (318-372)||(4842940-4842994)
chr2 (318-372)||(16523098-16523152)
chr2 (318-372)||(27109151-27109205)
chr2 (318-372)||(31909316-31909370)
chr2 (318-372)||(40125075-40125129)
chr2 (318-372)||(43672041-43672095)
chr2 (319-371)||(1295385-1295437)
chr2 (311-374)||(10374913-10374972)
chr2 (318-373)||(2481302-2481357)
chr2 (312-351)||(36622349-36622388)
chr2 (318-373)||(41451946-41452001)
chr2 (318-372)||(1696230-1696284)
chr2 (326-372)||(3832388-3832434)
chr2 (318-372)||(4042727-4042781)
chr2 (318-372)||(10671739-10671793)
chr2 (318-360)||(29182277-29182319)
chr2 (326-372)||(34317915-34317961)
chr2 (326-372)||(35686178-35686224)
chr2 (318-348)||(37228831-37228861)
chr2 (318-372)||(37910957-37911011)
chr2 (323-372)||(13215262-13215311)
chr2 (319-372)||(44559246-44559299)
chr2 (324-360)||(13850635-13850671)
chr2 (322-370)||(38231544-38231592)
[»] chr1 (91 HSPs)
chr1 (311-374)||(990188-990251)
chr1 (311-374)||(12361112-12361175)
chr1 (311-374)||(18473373-18473436)
chr1 (311-374)||(41358499-41358562)
chr1 (311-374)||(3679725-3679788)
chr1 (311-374)||(4323930-4323993)
chr1 (311-374)||(7001732-7001795)
chr1 (311-374)||(15335130-15335193)
chr1 (311-374)||(31258441-31258504)
chr1 (311-374)||(32728885-32728948)
chr1 (311-374)||(48955901-48955964)
chr1 (312-374)||(24649452-24649514)
chr1 (312-373)||(29688269-29688330)
chr1 (311-374)||(2733285-2733348)
chr1 (311-374)||(13260087-13260150)
chr1 (311-370)||(14007588-14007647)
chr1 (311-374)||(19622757-19622820)
chr1 (311-374)||(32454126-32454189)
chr1 (311-374)||(32626729-32626792)
chr1 (311-374)||(35307946-35308009)
chr1 (311-374)||(41881195-41881258)
chr1 (311-374)||(44641271-44641333)
chr1 (312-374)||(18302219-18302281)
chr1 (312-374)||(45290559-45290621)
chr1 (311-374)||(1159676-1159739)
chr1 (311-374)||(10552149-10552212)
chr1 (311-374)||(17984532-17984595)
chr1 (311-374)||(21383203-21383266)
chr1 (311-374)||(21391214-21391276)
chr1 (311-370)||(26062058-26062117)
chr1 (312-374)||(4360370-4360432)
chr1 (316-374)||(35005491-35005549)
chr1 (311-372)||(22919783-22919844)
chr1 (311-372)||(26191459-26191520)
chr1 (312-372)||(18899973-18900033)
chr1 (312-372)||(33067569-33067629)
chr1 (311-374)||(7818938-7819001)
chr1 (311-374)||(34383047-34383110)
chr1 (312-374)||(33379989-33380051)
chr1 (311-373)||(50429047-50429108)
chr1 (311-360)||(13770590-13770639)
chr1 (312-372)||(16083154-16083214)
chr1 (312-372)||(46868329-46868389)
chr1 (311-372)||(1811109-1811170)
chr1 (311-372)||(11822104-11822165)
chr1 (311-360)||(20756120-20756169)
chr1 (311-374)||(26442736-26442797)
chr1 (312-372)||(34808296-34808356)
chr1 (312-360)||(48609445-48609493)
chr1 (312-372)||(52254283-52254343)
chr1 (312-359)||(29072600-29072647)
chr1 (335-374)||(49226361-49226400)
chr1 (322-372)||(19198786-19198836)
chr1 (318-372)||(24510051-24510105)
chr1 (318-372)||(48730455-48730509)
chr1 (318-371)||(8364814-8364867)
chr1 (313-374)||(22953393-22953454)
chr1 (322-374)||(18927890-18927942)
chr1 (311-347)||(26142521-26142557)
chr1 (312-360)||(27521676-27521724)
chr1 (312-372)||(37545790-37545850)
chr1 (312-359)||(45368702-45368749)
chr1 (318-372)||(4789417-4789471)
chr1 (318-372)||(10887342-10887396)
chr1 (318-360)||(12360712-12360754)
chr1 (318-372)||(16060704-16060758)
chr1 (318-372)||(17129921-17129975)
chr1 (326-372)||(18079516-18079562)
chr1 (323-373)||(42483167-42483217)
chr1 (318-360)||(49073902-49073944)
chr1 (320-357)||(32420208-32420245)
chr1 (312-372)||(3753312-3753372)
chr1 (322-374)||(12322718-12322770)
chr1 (318-370)||(19720913-19720965)
chr1 (328-372)||(24977898-24977942)
chr1 (311-354)||(292959-293002)
chr1 (318-373)||(10631364-10631419)
chr1 (318-373)||(16026774-16026829)
chr1 (318-369)||(26324787-26324838)
chr1 (318-373)||(33000505-33000560)
chr1 (318-373)||(38150957-38151012)
chr1 (322-372)||(5058838-5058888)
chr1 (326-360)||(15466249-15466283)
chr1 (332-370)||(39303836-39303874)
chr1 (326-372)||(41738913-41738959)
chr1 (325-374)||(34002691-34002740)
chr1 (328-360)||(33045475-33045507)
chr1 (328-360)||(39747592-39747624)
chr1 (328-360)||(44157891-44157923)
chr1 (332-372)||(46183812-46183852)
chr1 (326-370)||(51986415-51986459)
[»] scaffold0712 (1 HSPs)
scaffold0712 (311-374)||(5311-5374)
[»] scaffold0709 (1 HSPs)
scaffold0709 (311-374)||(5331-5394)
[»] scaffold0373 (1 HSPs)
scaffold0373 (311-374)||(8649-8712)
[»] scaffold0210 (1 HSPs)
scaffold0210 (311-374)||(14797-14860)
[»] scaffold0159 (1 HSPs)
scaffold0159 (311-374)||(35107-35170)
[»] scaffold0021 (1 HSPs)
scaffold0021 (311-374)||(12284-12347)
[»] scaffold0811 (1 HSPs)
scaffold0811 (311-374)||(1479-1542)
[»] scaffold0535 (1 HSPs)
scaffold0535 (311-374)||(8864-8926)
[»] scaffold0123 (1 HSPs)
scaffold0123 (311-374)||(17879-17942)
[»] scaffold0051 (1 HSPs)
scaffold0051 (311-374)||(5542-5605)
[»] scaffold0016 (1 HSPs)
scaffold0016 (311-374)||(10257-10320)
[»] scaffold0347 (1 HSPs)
scaffold0347 (312-374)||(4149-4211)
[»] scaffold0179 (1 HSPs)
scaffold0179 (311-370)||(3132-3191)
[»] scaffold0060 (1 HSPs)
scaffold0060 (311-372)||(8432-8493)
[»] scaffold0002 (1 HSPs)
scaffold0002 (312-372)||(94160-94220)
[»] scaffold0003 (1 HSPs)
scaffold0003 (312-372)||(366114-366174)
[»] scaffold0326 (2 HSPs)
scaffold0326 (320-367)||(4128-4175)
scaffold0326 (320-367)||(19310-19357)
[»] scaffold0166 (1 HSPs)
scaffold0166 (311-374)||(24495-24558)
[»] scaffold1001 (1 HSPs)
scaffold1001 (312-359)||(2878-2925)
[»] scaffold0684 (1 HSPs)
scaffold0684 (326-372)||(2412-2458)
[»] scaffold0119 (1 HSPs)
scaffold0119 (318-372)||(16832-16886)
[»] scaffold0007 (1 HSPs)
scaffold0007 (322-371)||(2615-2664)
[»] scaffold0065 (1 HSPs)
scaffold0065 (312-360)||(3770-3818)
[»] scaffold0026 (1 HSPs)
scaffold0026 (318-374)||(82450-82506)
[»] scaffold0005 (1 HSPs)
scaffold0005 (316-348)||(47972-48004)
[»] scaffold0105 (1 HSPs)
scaffold0105 (312-360)||(17813-17863)
[»] scaffold0056 (2 HSPs)
scaffold0056 (318-373)||(49914-49969)
scaffold0056 (318-373)||(55015-55070)
[»] scaffold0011 (1 HSPs)
scaffold0011 (318-357)||(189437-189476)
[»] scaffold0001 (1 HSPs)
scaffold0001 (329-372)||(148007-148050)
[»] scaffold0176 (1 HSPs)
scaffold0176 (326-358)||(21807-21839)


Alignment Details
Target: chr5 (Bit Score: 136; Significance: 9e-71; HSPs: 76)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 3 - 163
Target Start/End: Complemental strand, 1912287 - 1912121
Alignment:
Q  3 agaggagaagcaaaggtttacgtgggagaaggaaatgaggagaagtgtgtgtttgagaggagcaggagagggatagagggttggtggcggccatggaaat 102  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1912287 agaggagaagaaaaggtttacgtgggagaaggaaatgaggagaagtgtgtgtttgagaggagcaggagagggatagagggttggtggcggccatggaaat 1912188  T
Q  103 ggaaat------ggaatggagtttgtgagaaggaaagtgaaagtttctgtttctgcatttgtggata 163  Q
    ||||||      ||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  1912187 ggaaatggaaatggaatggagtttgtgagaaggaaagtgaaagtttctgtttctgcattcgtggata 1912121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 2217756 - 2217693
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2217756 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 2217693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 6118393 - 6118330
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6118393 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6118330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 15635477 - 15635540
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15635477 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 15635540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 18633859 - 18633796
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18633859 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18633796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35166058 - 35165995
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35166058 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35165995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 161 - 226
Target Start/End: Complemental strand, 1912100 - 1912035
Alignment:
Q  161 ataacgtaagaggataatcaaacatgtcgttgtgtttctgtcttggccacatttctaattttagtt 226  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  1912100 ataacgtaagaggataatgaaacatgtcgttgtgtttctgtcttggccacatttctaattttagtt 1912035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 294091 - 294028
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  294091 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 294028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 5614428 - 5614365
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  5614428 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5614365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 16616463 - 16616526
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16616463 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 16616526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 27850275 - 27850212
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  27850275 gaaaatagtccctgaccccacttttgtgatggtttgcatacgtggcacattataactgaaccaa 27850212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 29151618 - 29151681
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  29151618 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 29151681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 29172625 - 29172688
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  29172625 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 29172688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 29692991 - 29692928
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  29692991 gaaaatagtccctgaccccacttttatgatgatttgcatacgtggcacattataactgaaccaa 29692928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35167064 - 35167001
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35167064 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35167001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 36577821 - 36577884
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  36577821 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 36577884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 38962992 - 38962929
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  38962992 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 38962929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 42207342 - 42207405
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  42207342 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 42207405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Complemental strand, 25779060 - 25779000
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  25779060 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 25779000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 21050675 - 21050738
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  21050675 gaaaatagtccttgacctcacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21050738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 23382208 - 23382145
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||    
T  23382208 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 23382145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 28550927 - 28550990
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  28550927 gaaaatagtccctaaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa 28550990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 29875501 - 29875564
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||    
T  29875501 gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa 29875564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 30888262 - 30888325
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||    
T  30888262 gaaaatagtccctgaccccacttttgtgatgatttgcatatatggcacattataactgaaccaa 30888325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 31037497 - 31037560
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  31037497 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31037560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 38496521 - 38496584
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  38496521 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 38496584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 371
Target Start/End: Complemental strand, 37090640 - 37090580
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  37090640 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 37090580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 4203554 - 4203617
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||    
T  4203554 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacatattataattgaaccaa 4203617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 5950274 - 5950337
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  5950274 gaaaatagtctttgaccccacttttgtgatgatttgcatacgtggcacattataactgatccaa 5950337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 7075860 - 7075797
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||    
T  7075860 gaaaatagtccctggctccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 7075797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 16038638 - 16038575
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
T  16038638 gaaaatagtctctgaccccacttttgtgattatttgcatacgtgacacattataactgaaccaa 16038575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 18046250 - 18046187
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
T  18046250 gaaaatagtctctgaccccacttttgtgataatttgcatacgtgtcacattataactgaaccaa 18046187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 313 - 374
Target Start/End: Complemental strand, 21125170 - 21125109
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||| ||||||||||||| |||||||||| ||||||||    
T  21125170 aaatagtccctgaccccacttttgtgataatttgcatacgtgacacattataattgaaccaa 21125109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 10409033 - 10409095
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||    
T  10409033 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactaaaccaa 10409095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 30800750 - 30800687
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||  ||||||||||| |||||||||||||| ||||||||||||||||||    
T  30800750 gaaaatagtccctgacctgacttttgtgattatttgcatacgtggtacattataactgaaccaa 30800687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 33335923 - 33335864
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||    
T  33335923 gaaaatagtccttgaccccacttttgtgattatttgcatacgtgacacattataactgaa 33335864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 39379330 - 39379393
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| || ||||||||| |||||||||||||||||| |||||||||||||||||||    
T  39379330 gaaaatagtcccggatcccacttttatgatgatttgcatacgtgacacattataactgaaccaa 39379393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 311 - 373
Target Start/End: Original strand, 38786259 - 38786321
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||||    
T  38786259 gaaaatagtctctgacctcatttttgtgatgatttgcatacgtgacacattataactgaacca 38786321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 3850525 - 3850465
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  3850525 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 3850465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 28863732 - 28863672
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
T  28863732 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgtcacatgatgactgaacc 28863672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 372
Target Start/End: Complemental strand, 14318300 - 14318239
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||| | ||||||||||||||||||||||| ||||| || ||||||||    
T  14318300 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc 14318239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 10743953 - 10743893
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||| ||| ||||| || ||||||||    
T  10743953 aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcacatgatgactgaacc 10743893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 312 - 371
Target Start/End: Complemental strand, 22551214 - 22551155
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||||||||||  ||||||||||| |||| || |||||||    
T  22551214 aaaatagtccctgaccccacttttgtgatgagctgcatacgtggtacatgatgactgaac 22551155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 24782175 - 24782112
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||  || ||||||||||||||||||||||| ||||||| |||||||||    
T  24782175 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa 24782112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 40029240 - 40029303
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| || |||||||||||||||||   ||||||| |||||||||||||||||||    
T  40029240 gaaaatagtccctaactccacttttgtgatgattgatatacgtgacacattataactgaaccaa 40029303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 20690840 - 20690882
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
T  20690840 gtccctgaccccacttttgtgatgatttgcatacatggcacat 20690882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 27916564 - 27916626
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||| ||||||||| ||||||||||||| || || || ||||||||||    
T  27916564 aaaatagtccctgaccccatttttgtgataatttgcatacgtgacagatgatgactgaaccaa 27916626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 315 - 372
Target Start/End: Complemental strand, 3850719 - 3850662
Alignment:
Q  315 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| ||||||||| || |||||||||||||||||||||||||| || ||||||||    
T  3850719 atagtctctgaccccatttatgtgatgatttgcatacgtggcacatgatgactgaacc 3850662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Original strand, 13990708 - 13990756
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| |||||| | |||||||||||||||||||||||||||||    
T  13990708 aaaatagtccatgaccctatttttgtgatgatttgcatacgtggcacat 13990756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 320 - 360
Target Start/End: Original strand, 17070646 - 17070686
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||||| |||||||||||    
T  17070646 ccctgaccccacttttgtgatgatttgcacacgtggcacat 17070686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 316 - 372
Target Start/End: Original strand, 26071397 - 26071453
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||| ||||||||||||||||||||||||||| |||| |||||| || ||||||||    
T  26071397 tagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatgactgaacc 26071453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 37271597 - 37271542
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  37271597 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaacca 37271542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 4736433 - 4736379
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| |||||||||||||||| |||| ||||||||||| || ||||||||    
T  4736433 gtccctgactccacttttgtgatgatctgcacacgtggcacatgatgactgaacc 4736379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 5904260 - 5904210
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| |||||||||||||||||||||||||| || || |||||||||||    
T  5904260 ctgacctcacttttgtgatgatttgcatacgtgacatatgataactgaacc 5904210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 10830638 - 10830692
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||| ||||| ||||  || ||||||||    
T  10830638 gtccctgaccccacttttgtgatgatttgcacacgtgacacaagatgactgaacc 10830692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 20661057 - 20661099
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||||||| ||||| |||||    
T  20661057 gtccctgaccccacttttgtgatgatttgcacacgtgacacat 20661099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 317 - 370
Target Start/End: Original strand, 25561814 - 25561868
Alignment:
Q  317 agtccctgaccccac-ttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||| |||||||||| ||||||||||||||||||| || ||||||||||||||||    
T  25561814 agtctctgaccccaccttttgtgatgatttgcatatgtagcacattataactgaa 25561868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 31602264 - 31602310
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||||||||| |||| ||||||    
T  31602264 ccccacttttgtgatgatttgcacacgtggcacatgataattgaacc 31602310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 40038604 - 40038658
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  40038604 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40038658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 9179820 - 9179760
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| | ||||||| | |||||||||||||| |||||||||||| ||||| |||||    
T  9179820 aaaatagtctccgaccccattattgtgatgatttgcctacgtggcacatgataaccgaacc 9179760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 374
Target Start/End: Complemental strand, 11935861 - 11935805
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| ||||| |||||||||||| |||||| |||| |||||| ||||||    
T  11935861 gtccctgaccccccttttatgatgatttgcacacgtggtacatgataactcaaccaa 11935805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 29366847 - 29366799
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||| |||||||||||| |||||||||||||| |||||||| |||||    
T  29366847 aaaataatccctgaccccatttttgtgatgatttacatacgtgacacat 29366799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 32108926 - 32108970
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  32108926 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 32108970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 34125408 - 34125467
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||| | |||| |||||||||||||||||||||||| || ||||||||    
T  34125408 aaaatagtctctgaccc-atttttttgatgatttgcatacgtggcacatgatgactgaacc 34125467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 371
Target Start/End: Original strand, 18286530 - 18286589
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||| ||| ||||| |||||||||||||| ||||||||||| || || |||||||    
T  18286530 aaaatagtctctggccccagttttgtgatgatttacatacgtggcatatgatgactgaac 18286589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 19685125 - 19685180
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  19685125 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 19685180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 24443489 - 24443544
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  24443489 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 24443544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 371
Target Start/End: Original strand, 28107918 - 28107961
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
T  28107918 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 28107961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 1286938 - 1286884
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| |||||||||||||||||||||||  |||| ||||| || ||||||||    
T  1286938 gtccctgtccccacttttgtgatgatttgcaagcgtgacacataatgactgaacc 1286884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 2636778 - 2636820
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  2636778 gtccctggctccacttttgtgatgatttgcacacgtggcacat 2636820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 9588499 - 9588449
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||| ||||||||||||| |||| |||||||||||||| || ||||||||    
T  9588499 ctgactccacttttgtgataatttacatacgtggcacatgatgactgaacc 9588449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 28213490 - 28213536
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  28213490 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 28213536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 35609382 - 35609436
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  35609382 gtccctgtcgccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 35609436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 9532291 - 9532340
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| | || ||||| ||||||||||||||||||||||| |||||    
T  9532291 gaaaatagttcttggccccatttttgtgatgatttgcatacgtgacacat 9532340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 327 - 372
Target Start/End: Original strand, 32888798 - 32888843
Alignment:
Q  327 cccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| || ||||||||||| || ||||||||    
T  32888798 cccacttttgtgatgatttacacacgtggcacatgatgactgaacc 32888843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 312 - 348
Target Start/End: Complemental strand, 26133311 - 26133275
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgca 348  Q
    |||||||||||| |||||| |||||||||||||||||    
T  26133311 aaaatagtccctaaccccatttttgtgatgatttgca 26133275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0370 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: scaffold0370
Description:

Target: scaffold0370; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 188 - 125
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  188 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 64; Significance: 8e-28; HSPs: 75)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 4375791 - 4375854
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4375791 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4375854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 6146847 - 6146784
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6146847 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6146784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 19494220 - 19494283
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19494220 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19494283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 38930403 - 38930466
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38930403 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 38930466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 40493054 - 40493117
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40493054 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 40493117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 4017005 - 4017067
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4017005 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4017067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 311 - 373
Target Start/End: Original strand, 21509796 - 21509858
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21509796 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 21509858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 1525911 - 1525974
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  1525911 gaaaatagtccctgaccccacttttgtgatgatttgcataagtggcacattataactgaaccaa 1525974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 6146616 - 6146679
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6146616 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6146679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 22917826 - 22917763
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  22917826 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22917763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 33636424 - 33636487
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  33636424 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacagaaccaa 33636487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 1163013 - 1163076
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  1163013 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 1163076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1408253 - 1408190
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  1408253 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcatattataactgaaccaa 1408190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 8094581 - 8094644
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
T  8094581 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa 8094644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 14495299 - 14495236
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  14495299 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacctaataactgaaccaa 14495236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 16643942 - 16643879
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||    
T  16643942 gaaaatagtcccttaccccaattttgtgatgatttgcatacgtggcacattataactgaaccaa 16643879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 24187668 - 24187731
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  24187668 gaaaatagtctctgaccccacttttgtgatgatttgcatacttggcacattataactgaaccaa 24187731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 25131210 - 25131273
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  25131210 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 25131273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 28398938 - 28398875
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
T  28398938 gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 28398875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 21125919 - 21125857
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  21125919 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 21125857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 10776397 - 10776334
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||    
T  10776397 gaaaatagtccttgaccccacttttgtgatgattttcatacgtggcacattatgactgaaccaa 10776334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 315 - 374
Target Start/End: Complemental strand, 16789268 - 16789209
Alignment:
Q  315 atagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  16789268 atagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 16789209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 366
Target Start/End: Original strand, 22650568 - 22650623
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 366  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  22650568 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataac 22650623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 32040272 - 32040209
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||    
T  32040272 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataattgaaccaa 32040209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 40066595 - 40066658
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  40066595 gaaaatagtctctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 40066658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 311 - 369
Target Start/End: Original strand, 1685216 - 1685274
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 369  Q
    |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||    
T  1685216 gaaaataggccctaaccccacttttgtgatgatttgcatacgtggcacattataactga 1685274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 15719758 - 15719818
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  15719758 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 15719818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 33526155 - 33526215
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  33526155 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 33526215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 7272522 - 7272585
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||  |||||||||||||||||||||||||||||  ||||||||||||||||||    
T  7272522 gaaaatagtccctagccccacttttgtgatgatttgcatacgtgttacattataactgaaccaa 7272585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 366
Target Start/End: Complemental strand, 24954910 - 24954855
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 366  Q
    |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||    
T  24954910 gaaaatagtccctgaccccacttttgtgatgatttgcataagtgacacattataac 24954855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 14488816 - 14488877
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||| || ||||||||    
T  14488816 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 14488877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 14238852 - 14238912
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| | || ||||||||    
T  14238852 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacctgatgactgaacc 14238912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 19963099 - 19963159
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| |||||||||||||||||||||||| | || |||||||||||    
T  19963099 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgataactgaacc 19963159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 27341489 - 27341426
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||| | || ||||| ||||||||||||||||||||||||||    
T  27341489 gaaaatagtctctgaccccacttttgcggtggtttgcttacgtggcacattataactgaaccaa 27341426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 28497363 - 28497417
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || ||||||||    
T  28497363 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 28497417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 35115590 - 35115536
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||||||||| ||||| || ||||||||    
T  35115590 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaacc 35115536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 18549305 - 18549354
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||    
T  18549305 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 18549354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 30337023 - 30337084
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| |||||||||||||||||||||||| | || || ||||||||    
T  30337023 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggtatatgatgactgaacc 30337084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 10755429 - 10755369
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||||||||| || ||||||||    
T  10755429 aaaatagtccccgactccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 10755369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 29488009 - 29487949
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| ||||||||||||||||||| ||||||||| || ||||||||    
T  29488009 aaaatagtccttgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 29487949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 32418577 - 32418529
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||    
T  32418577 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 32418529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 40844434 - 40844386
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||    
T  40844434 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacat 40844386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 43477411 - 43477351
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||| | ||||| || ||||||||    
T  43477411 aaaatagtccctgaccccatttttgtgatgatttgcatacgagtcacatgatgactgaacc 43477351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 43727328 - 43727268
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||||| || ||||||||    
T  43727328 aaaatagtccttgaccccatttttgtgatgatttggatacgtggcacatgatgactgaacc 43727268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 8298696 - 8298750
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  8298696 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 8298750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 14496914 - 14496975
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| |||||||||| || ||||||||||||||||||| ||||||||| || ||||||||    
T  14496914 gaaaatcgtccctgacctcatttttgtgatgatttgcatatgtggcacatgatgactgaacc 14496975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 20277801 - 20277854
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| ||||||||||||||||||||| | ||||||||||| ||||||||||    
T  20277801 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 20277854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 21064428 - 21064481
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| ||||||||||||||||||||| | ||||||||||| ||||||||||    
T  21064428 gtccctggccccacttttgtgatgatttgaacacgtggcacatgataactgaac 21064481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 7578429 - 7578369
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||  |||||| | ||||||||||||||||||||||||||||| || ||||||||    
T  7578429 aaaatagtctttgacccaatttttgtgatgatttgcatacgtggcacatgatgactgaacc 7578369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 35143743 - 35143684
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| ||||||||||||||||||| ||||||||| ||||| |||||    
T  35143743 aaaatagtccatgacccca-ttttgtgatgatttgcataagtggcacatgataaccgaacc 35143684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 316 - 371
Target Start/End: Original strand, 23939654 - 23939709
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||||||||||||||| | ||| ||||| || |||||||    
T  23939654 tagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatgactgaac 23939709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 29158456 - 29158519
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| || |||||||||||||||| ||||  ||||||| |||| ||||||||||||||    
T  29158456 gaaaatagtctcttaccccacttttgtgataatttatatacgtgacacaatataactgaaccaa 29158519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 6469557 - 6469503
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||  | |||||||||||||| ||||||||    
T  6469557 gtccctgaccccacttttgtgattatttaaacacgtggcacattatgactgaacc 6469503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 7326195 - 7326249
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  7326195 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 7326249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 7420339 - 7420393
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  7420339 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 7420393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 29992192 - 29992138
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||||| || ||||| ||||| || ||||||||    
T  29992192 gtccctgaccccacttttgtgatgatttacacacgtgacacatgatgactgaacc 29992138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 42430011 - 42429957
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| ||||| ||||||||||||||||| ||||||||||| || ||||||||    
T  42430011 gtccctggccccatttttgtgatgatttgcacacgtggcacatgatgactgaacc 42429957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 360
Target Start/End: Original strand, 2811555 - 2811592
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||||||| |||||||||||||    
T  2811555 tgaccccacttttgtgatgatttgtatacgtggcacat 2811592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 372
Target Start/End: Complemental strand, 15931155 - 15931106
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  15931155 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacc 15931106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 32195381 - 32195430
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| |||||||||||||| ||||||| |||||||||| |||||    
T  32195381 gaaaatagtctctgaccccacttttatgatgatatgcatacgtgacacat 32195430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 370
Target Start/End: Original strand, 1778673 - 1778725
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||    
T  1778673 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaa 1778725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 324 - 372
Target Start/End: Complemental strand, 9175257 - 9175209
Alignment:
Q  324 gaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||| || |||||||| || ||||||||    
T  9175257 gaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc 9175209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 370
Target Start/End: Original strand, 13154995 - 13155047
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||  ||||||||| ||||||||||| || ||||||    
T  13154995 gtccctgaccccacttttgtattgatttgcacacgtggcacatgatgactgaa 13155047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 370
Target Start/End: Original strand, 24814814 - 24814866
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||||||||||||| |||||||||| |||| |||||| || ||||||    
T  24814814 gtccctgaccccacttttgttatgatttgcacacgtagcacatgatgactgaa 24814866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 11976627 - 11976572
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  11976627 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 11976572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 371
Target Start/End: Complemental strand, 17074061 - 17074006
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||| |||||||| |||||||||||| ||||| ||||| || |||||||    
T  17074061 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17074006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 316 - 371
Target Start/End: Original strand, 17574209 - 17574264
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||| |||||||| |||||||||||| ||||| ||||| || |||||||    
T  17574209 tagtccctgactccacttttatgatgatttgcacacgtgacacatgatgactgaac 17574264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 4473813 - 4473855
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  4473813 gtccctggctccacttttgtgatgatttgcacacgtggcacat 4473855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 10540558 - 10540600
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  10540558 gtccctggctccacttttgtgatgatttgcacacgtggcacat 10540600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 10873172 - 10873118
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||| ||||||||||||||||| ||||||||||| || ||||||||    
T  10873172 gtccctggctccaattttgtgatgatttgcacacgtggcacatgatgactgaacc 10873118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 13232307 - 13232361
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  13232307 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 13232361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Complemental strand, 13779426 - 13779384
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||| |||||||||||||||||||||||||| | |||||||||    
T  13779426 gtccatgaccccacttttgtgatgatttgcacatgtggcacat 13779384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 44998146 - 44998104
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
T  44998146 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 44998104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 42132973 - 42133026
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| | ||||||||||||||||||||| || |||||||| || |||||||    
T  42132973 gtccctggctccacttttgtgatgatttgcacacctggcacatgatgactgaac 42133026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 318 - 354
Target Start/End: Complemental strand, 5357654 - 5357618
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtg 354  Q
    ||||||||| ||||||||||||||||||||| |||||    
T  5357654 gtccctgactccacttttgtgatgatttgcacacgtg 5357618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 8e-28; HSPs: 73)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1007128 - 1007065
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1007128 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 1007065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 6108596 - 6108533
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6108596 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6108533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 7432053 - 7432116
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7432053 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 7432116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 39719455 - 39719518
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39719455 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 39719518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 45021597 - 45021660
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45021597 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 45021660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1559605 - 1559542
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  1559605 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 1559542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 12894301 - 12894238
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12894301 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 12894238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 19783916 - 19783979
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  19783916 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19783979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 21223508 - 21223571
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21223508 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21223571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 30709425 - 30709488
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  30709425 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 30709488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 31732350 - 31732287
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  31732350 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 31732287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35015118 - 35015055
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35015118 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35015055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 45073541 - 45073478
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45073541 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 45073478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 46304281 - 46304218
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46304281 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 46304218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 48358975 - 48358913
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48358975 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 48358913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 28911679 - 28911740
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  28911679 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaacc 28911740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 488814 - 488877
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  488814 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 488877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 5308586 - 5308523
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  5308586 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 5308523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 14738700 - 14738763
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14738700 gaaaatagtctctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14738763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 17999623 - 17999560
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||    
T  17999623 gaaaatagtccctgaccccacgtttgtgataatttgcatacgtggcacattataactgaaccaa 17999560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 19561249 - 19561312
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
T  19561249 gaaaatagtccctgacaccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 19561312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 21554652 - 21554589
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||    
T  21554652 gaaaatagtccctgaccccacttttgtgatgttttgcatatgtggcacattataactgaaccaa 21554589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 22871162 - 22871225
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  22871162 gaaaatagaccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 22871225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 30352662 - 30352725
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||    
T  30352662 gaaaatagtccctgactccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 30352725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 37372804 - 37372741
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
T  37372804 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgatacattataactgaaccaa 37372741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 44344690 - 44344627
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  44344690 gaaaatagtcactgaccccacttttgtgatgattttcatacgtggcacattataactgaaccaa 44344627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 44403151 - 44403088
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  44403151 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacgttataactgaaccaa 44403088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 18022468 - 18022530
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  18022468 aaaataatccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 18022530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 18311682 - 18311744
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  18311682 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa 18311744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 25547390 - 25547327
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
T  25547390 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtgacacattataactgaaccaa 25547327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 39833005 - 39833068
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  39833005 gaaaatagttcctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 39833068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 44508820 - 44508883
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||    
T  44508820 gaaaatagtctctgaccccacttttgttatgatttgcatacgtggcacattataagtgaaccaa 44508883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 10358105 - 10358167
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||    
T  10358105 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa 10358167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 370
Target Start/End: Complemental strand, 31310577 - 31310519
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||    
T  31310577 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattatgactgaa 31310519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 35210411 - 35210352
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||    
T  35210411 gaaaatagtccttaaccccacttttgtgatgatgtgcatacgtggcacattataactgaa 35210352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 19757851 - 19757912
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  19757851 gaaaatagtcactgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19757912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 35665984 - 35666037
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||||||||||||||||||| ||||| || |||||||    
T  35665984 gtccctgaccccacttttgtgatgatttgcatacgtgacacatgatgactgaac 35666037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 20388376 - 20388436
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||| |||||||||| |||||||||||||||||||||||||| || || ||||||||    
T  20388376 aaaatagttcctgaccccatttttgtgatgatttgcatacgtggcatatgatgactgaacc 20388436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 9659464 - 9659518
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  9659464 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 9659518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 13769874 - 13769933
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||| | ||||||||||||||||||||||||||||| || ||||||||    
T  13769874 aaaatagtcc-tgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaacc 13769933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 23816933 - 23816885
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||| ||||||||||||||| |||||||||||||    
T  23816933 aaaatagtctctgaccccatttttgtgatgatttgtatacgtggcacat 23816885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 316 - 360
Target Start/End: Original strand, 35104125 - 35104169
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||    
T  35104125 tagtccctgactccacttttgtgatgatttgcacacgtggcacat 35104169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 37952950 - 37952902
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| |||||||||||||||||| |||||||||||| ||||||    
T  37952950 aaaatagtccatgaccccacttttgtgattatttgcatacgtagcacat 37952902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 46648516 - 46648575
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| |||||||||||||||| |||||||||||| || ||||||||    
T  46648516 aaaatagtcc-tgaccccatttttgtgatgatttgcgtacgtggcacatgatgactgaacc 46648575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 325 - 372
Target Start/End: Original strand, 19465733 - 19465780
Alignment:
Q  325 accccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| ||||||||||||||||||||||||||||| || ||||||||    
T  19465733 accccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19465780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 312 - 371
Target Start/End: Original strand, 45671314 - 45671373
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||| ||||||||| || ||||||||||||||||||||||| ||||| || |||||||    
T  45671314 aaaataatccctgacctcatttttgtgatgatttgcatacgtgacacatgatgactgaac 45671373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Complemental strand, 2945736 - 2945694
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| |||||||||||    
T  2945736 gtccctggccccacttttgtgatgatttgcacacgtggcacat 2945694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 5355009 - 5354955
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  5355009 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 5354955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 313 - 355
Target Start/End: Complemental strand, 17854356 - 17854314
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtgg 355  Q
    |||||||||||||| ||| ||||||||||||||||||||||||    
T  17854356 aaatagtccctgactccatttttgtgatgatttgcatacgtgg 17854314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 35838033 - 35838075
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||||||||||||||| |||||||||||    
T  35838033 gtccctgactccacttttgtgatgatttgcacacgtggcacat 35838075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 39520507 - 39520561
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  39520507 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 39520561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 46759864 - 46759810
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  46759864 gtccctgactccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 46759810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 374
Target Start/End: Complemental strand, 1974207 - 1974162
Alignment:
Q  329 cacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||| ||||||||||||||||||||| || ||||||||||||||||    
T  1974207 cactattgtgatgatttgcatacgtgacaaattataactgaaccaa 1974162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 3975730 - 3975677
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||| |||||||||| |||||||||| ||||||||||| || |||||||    
T  3975730 gtccctgactccacttttgtaatgatttgcacacgtggcacatgatgactgaac 3975677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 16940871 - 16940924
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||    
T  16940871 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaac 16940924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 11767036 - 11767080
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  11767036 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 11767080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 24954049 - 24953989
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||  ||||| ||||||| |||||||||||||| ||||||||| || ||||||||    
T  24954049 aaaatagtctttgacctcacttttatgatgatttgcatatgtggcacataatgactgaacc 24953989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 30223580 - 30223624
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  30223580 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 30223624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 357
Target Start/End: Original strand, 6892003 - 6892042
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggca 357  Q
    ||||||||||||||||||||||||||||||| | ||||||    
T  6892003 gtccctgaccccacttttgtgatgatttgcacaggtggca 6892042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 321 - 360
Target Start/End: Original strand, 34877885 - 34877924
Alignment:
Q  321 cctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||||||||||| ||| |||||||    
T  34877885 cctgaccccacttttgtgatgatttgcacacgcggcacat 34877924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 325 - 372
Target Start/End: Original strand, 44841471 - 44841518
Alignment:
Q  325 accccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||| | ||||||||||| || ||||||||    
T  44841471 accccacttttgtgatgatttggacacgtggcacatgatgactgaacc 44841518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 360
Target Start/End: Complemental strand, 6847007 - 6846969
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||  |||||||||||    
T  6847007 ctgaccccacttttgtgatgatttgcgcacgtggcacat 6846969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 27458508 - 27458562
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  27458508 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 27458562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 35470159 - 35470117
Alignment:
Q  330 acttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||| || ||||||||    
T  35470159 acttttgtgatgatttgcacacgtggcacatgatgactgaacc 35470117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 329 - 371
Target Start/End: Complemental strand, 38486673 - 38486631
Alignment:
Q  329 cacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||| ||||||||||| || |||||||    
T  38486673 cacttttgtgatgatttgcacacgtggcacatgatgactgaac 38486631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 41054067 - 41054013
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| | ||||||||| || ||||||||    
T  41054067 gtccctggctccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 41054013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 45228693 - 45228747
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||| ||||||||||||||||| ||||||||||| || ||||||||    
T  45228693 gtccctggctccatttttgtgatgatttgcacacgtggcacatgatgactgaacc 45228747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 41365112 - 41365054
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||  |||| | |||||||||||||||||||| |||||||| || ||||||||    
T  41365112 aaaatagtccc--acccaatttttgtgatgatttgcatacatggcacatgatgactgaacc 41365054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 360
Target Start/End: Complemental strand, 3808072 - 3808028
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||| |||||| |||||||||||||||||||| ||||| |||||    
T  3808072 tagtctctgacctcacttttgtgatgatttgcacacgtgacacat 3808028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 6589080 - 6589124
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  6589080 ccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 6589124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 327 - 371
Target Start/End: Complemental strand, 28262960 - 28262916
Alignment:
Q  327 cccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||| ||||| ||||| || |||||||    
T  28262960 cccacttttgtgatgatttgcacacgtgacacataatgactgaac 28262916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 43300730 - 43300770
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| |||||||||||||||||||||| || ||||||||    
T  43300730 ttttgtaatgatttgcatacgtggcacatgatgactgaacc 43300770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 318 - 374
Target Start/End: Complemental strand, 46829201 - 46829145
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||| || || ||||| || | ||||||||    
T  46829201 gtccctgactccacttttgtgatgatttgcacacatgacacatgatgattgaaccaa 46829145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 8e-28; HSPs: 54)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 14655669 - 14655606
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14655669 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14655606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 17321453 - 17321390
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17321453 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17321390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 17321586 - 17321523
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17321586 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17321523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 24273939 - 24274002
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24273939 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24274002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 33801642 - 33801579
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33801642 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 33801579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 8680877 - 8680940
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  8680877 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 8680940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 31166971 - 31167034
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  31166971 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 31167034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 31398440 - 31398377
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  31398440 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31398377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 34582631 - 34582694
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  34582631 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34582694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 313 - 374
Target Start/End: Original strand, 15962131 - 15962192
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15962131 aaatagtccctaaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 15962192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Complemental strand, 543622 - 543562
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  543622 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 543562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 777939 - 777875
Alignment:
Q  311 gaaaatagtccc-tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  777939 gaaaatagtcccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 777875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Complemental strand, 24692880 - 24692820
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  24692880 gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac 24692820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 494661 - 494602
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  494661 gaaaatagtccctgaccccacttttgtgatgatctgcatacgtggcacattataactgaa 494602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 2616134 - 2616071
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||    
T  2616134 gaaaatagtccctgaccacacttttgtgatgatttgcatacgtgacacattataactgaaccaa 2616071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 7155898 - 7155961
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7155898 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 7155961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 11129302 - 11129365
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||    
T  11129302 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcagatgataactgaaccaa 11129365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 15076103 - 15076040
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  15076103 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 15076040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 15116773 - 15116836
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||    
T  15116773 gaaaatagtccctgtccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 15116836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 19296305 - 19296242
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
T  19296305 gaaaatagtccctgaccccacttttgtgatgatttacatatgtggcacattataactgaaccaa 19296242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 30928944 - 30928881
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  30928944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa 30928881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 7324091 - 7324029
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||    
T  7324091 aaaatagtccctgaccccacttttatgatgatttgcatacggggcacattataactgaaccaa 7324029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 10091135 - 10091198
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  10091135 gaaaatagtccatgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 10091198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 32885774 - 32885837
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||    
T  32885774 gaaaatagtctctgcccctacttttgtgatgatttgcatacgtggcacattataactgaaccaa 32885837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 317911 - 317973
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||    
T  317911 aaaatagtctctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 317973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 26375794 - 26375856
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||    
T  26375794 aaaatagtccctaacctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa 26375856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 19275939 - 19275879
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  19275939 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 19275879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 21995167 - 21995227
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  21995167 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 21995227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 1890161 - 1890224
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||    
T  1890161 gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa 1890224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 3356400 - 3356337
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||| | ||||||||||||| |||||||||||||||||||    
T  3356400 gaaaatagtctctgaccccacttttgtgtttatttgcatacgtgacacattataactgaaccaa 3356337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 6468570 - 6468508
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||||    
T  6468570 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaaccaa 6468508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 6591339 - 6591277
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||| |||||| ||||||||||||||||||||||||||| |||||||||||| ||||||    
T  6591339 aaaatagtgcctgactccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 6591277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 14428751 - 14428811
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  14428751 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 14428811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 5286687 - 5286753
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgt---ggcacattataactgaaccaa 374  Q
    |||||||||||||| ||||||||||||||||||||||||| ||   |||||||||||| ||||||||    
T  5286687 gaaaatagtccctggccccacttttgtgatgatttgcatatgtggcggcacattataaatgaaccaa 5286753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 359
Target Start/End: Original strand, 17772014 - 17772062
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  17772014 gaaaatagtctctgaccccatttttgtgatgatttgcatacgtggcaca 17772062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 24901347 - 24901401
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||    
T  24901347 gtccctgactccacttttgtgatgatttgcacacgtgacacatgataactgaacc 24901401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 2373391 - 2373331
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
T  2373391 aaaatagccgctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 2373331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 12612256 - 12612196
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||| | ||| ||||||||||||||||||||||||||||| || ||||||||    
T  12612256 aaaatagtctctggctccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 12612196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 13617648 - 13617692
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| |||||||||||    
T  13617648 ccacttttgtgatgatttgcacacgtggcacatgataactgaacc 13617692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 33131626 - 33131686
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||| |||| | ||||||||||||||||||||||| ||||| || ||||||||    
T  33131626 aaaatagtccctaaccctatttttgtgatgatttgcatacgtgacacatgatgactgaacc 33131686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 12298927 - 12298969
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| |||||||||||    
T  12298927 gtccctggccccacttttgtgatgatttgcacacgtggcacat 12298969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 19320876 - 19320930
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  19320876 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 19320930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 31198724 - 31198778
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  31198724 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 31198778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 355
Target Start/End: Original strand, 13268218 - 13268255
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtgg 355  Q
    ||||||||||||||||||||||||||||||| ||||||    
T  13268218 gtccctgaccccacttttgtgatgatttgcacacgtgg 13268255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 3968754 - 3968809
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  3968754 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 3968809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 25121388 - 25121337
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 369  Q
    ||||||| ||||||||||||||||||||||| ||||| ||||| || |||||    
T  25121388 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactga 25121337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 371
Target Start/End: Original strand, 31185753 - 31185796
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||| ||||||||||| || |||||||    
T  31185753 ccacttttgtgatgatttgcacacgtggcacatgatgactgaac 31185796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 15722719 - 15722773
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||| |||||||||||| |||| ||||||| ||||| ||||| |||||||||||    
T  15722719 gtccccgaccccacttttatgatcatttgcacacgtgacacatgataactgaacc 15722773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 25137102 - 25137144
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  25137102 gtccctggctccacttttgtgatgatttgcacacgtggcacat 25137144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 327 - 372
Target Start/End: Complemental strand, 23629044 - 23628999
Alignment:
Q  327 cccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| | ||||||||||| || ||||||||    
T  23629044 cccacttttgtgatgatttgtacacgtggcacatgatgactgaacc 23628999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 372
Target Start/End: Original strand, 1214801 - 1214857
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| | | ||||||||||||||||||| ||||| ||||| || ||||||||    
T  1214801 tagtccctggctctacttttgtgatgatttgcacacgtgacacatgatgactgaacc 1214857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 9896537 - 9896477
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| | || |||| |||| ||||||||||||||||||||| || || ||||||||    
T  9896537 aaaatagtcaccgatcccatttttatgatgatttgcatacgtggcatatgatgactgaacc 9896477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 372
Target Start/End: Complemental strand, 23770400 - 23770360
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||| | || ||||||||    
T  23770400 ttttgtgatgatttgcatacgtggcacgtgatgactgaacc 23770360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 34990213 - 34990165
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| ||| |||| ||||||||||||||||| || ||||||||    
T  34990213 aaaatagtccttgatcccatttttgtgatgatttgcaaacatggcacat 34990165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 64; Significance: 8e-28; HSPs: 81)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 50714464 - 50714401
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50714464 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 50714401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 4279233 - 4279170
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4279233 gaaaatagtacctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4279170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 6827772 - 6827709
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  6827772 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 6827709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 13479371 - 13479434
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  13479371 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 13479434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 34355065 - 34355128
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  34355065 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34355128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 34362044 - 34361981
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34362044 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 34361981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 35415401 - 35415464
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  35415401 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35415464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 36702101 - 36702164
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  36702101 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattatgactgaaccaa 36702164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 41346117 - 41346054
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  41346117 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacattataactgaaccaa 41346054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 41620154 - 41620091
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  41620154 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 41620091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 55482369 - 55482306
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  55482369 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataattgaaccaa 55482306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 24474861 - 24474798
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  24474861 gaaaatagtccctgaccccacttttctgatgatttgcatacgtgacacattataactgaaccaa 24474798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 27427944 - 27428007
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||    
T  27427944 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacaatataactaaaccaa 27428007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 41920983 - 41920920
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
T  41920983 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtgacacattataactgaaccaa 41920920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 51708926 - 51708863
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
T  51708926 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 51708863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 52017768 - 52017705
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  52017768 gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 52017705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 53717071 - 53717009
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
T  53717071 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 53717009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 55072492 - 55072554
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  55072492 aaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 55072554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 313 - 366
Target Start/End: Original strand, 13064260 - 13064313
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13064260 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 13064313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 123793 - 123730
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||    
T  123793 gaaaatagtccctaaccctacttttgtggtgatttgcatacgtggcacattataactgaaccaa 123730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 18136014 - 18135951
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  18136014 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 18135951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 27008306 - 27008243
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  27008306 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 27008243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 29463812 - 29463749
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||    
T  29463812 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacattataattgaaccaa 29463749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 38054646 - 38054705
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||    
T  38054646 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtgacacattataactgaa 38054705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 49123222 - 49123159
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  49123222 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtgacacattataactaaaccaa 49123159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 313 - 374
Target Start/End: Complemental strand, 16712590 - 16712529
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||    
T  16712590 aaatagtccctgacgccacttttgtgatgatttgcatatgtggcacattataacttaaccaa 16712529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 3178784 - 3178847
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| | ||||||||||||| || |||||||||||||||||||    
T  3178784 gaaaatagtccctgaccccacttttttaatgatttgcatacatgacacattataactgaaccaa 3178847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 5063105 - 5063164
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||    
T  5063105 gaaaatagtccttgaccccacttttgtgatgatttgcatatgtggcacgttataactgaa 5063164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 366
Target Start/End: Complemental strand, 9446223 - 9446168
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataac 366  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  9446223 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgaaacattataac 9446168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 18830946 - 18831009
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||| || |||||||||||||||||||||||||| |||||||||||||||||||    
T  18830946 gaaaatagtcactggcctcacttttgtgatgatttgcatacgtgacacattataactgaaccaa 18831009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 22584509 - 22584446
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||||    
T  22584509 gaaaatagtccatgaccccacttctgtgatgatttgcatacatgacacattataactgaaccaa 22584446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 32208642 - 32208705
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||| ||||| ||||||| |||||||||||||||||||    
T  32208642 gaaaatagtccctgaccctacttttgtgattatttgtatacgtgacacattataactgaaccaa 32208705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35763853 - 35763790
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||| |||||||||||||| ||||||| ||||||||||||||||||||    
T  35763853 gaaaatagtcccttaccccaattttgtgatgatttacatacgtagcacattataactgaaccaa 35763790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 22099809 - 22099749
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  22099809 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 22099749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 316 - 372
Target Start/End: Complemental strand, 45505786 - 45505730
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  45505786 tagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 45505730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 45593328 - 45593387
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  45593328 aaaatagtccctgacccca-ttttgtgatgatttgcatacgtggcacatgatgactgaacc 45593387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 46087860 - 46087921
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| |||| |||||||||||||||||||||||  ||||||||||||||||||    
T  46087860 gaaaatagtccctgatcccatttttgtgatgatttgcatacgtg--acattataactgaaccaa 46087921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 330 - 374
Target Start/End: Complemental strand, 50822178 - 50822134
Alignment:
Q  330 acttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  50822178 acttttgtgatgatttgcatacgtggcacattataactgaaccaa 50822134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 51545868 - 51545808
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||| || ||||||||    
T  51545868 aaaatagtccctgatcccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 51545808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 11692870 - 11692924
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||||| |||||||||||||| || ||||||||    
T  11692870 gtccctgaccccacttttgtgatgattttcatacgtggcacatgatgactgaacc 11692924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 7642544 - 7642491
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || |||||||    
T  7642544 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 7642491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 2180471 - 2180411
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| |||||||||||||||||||||||  |||| || ||||||||    
T  2180471 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgagacatgatgactgaacc 2180411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 18205256 - 18205316
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||  ||||||||||||||||||||||||||||||||  |||||||| ||||||    
T  18205256 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgatacattatagctgaac 18205316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Original strand, 32365196 - 32365244
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||    
T  32365196 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacat 32365244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 323 - 367
Target Start/End: Original strand, 52429825 - 52429869
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataact 367  Q
    |||||||| ||||||||||||||||||||||||||||||||||||    
T  52429825 tgaccccatttttgtgatgatttgcatacgtggcacattataact 52429869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 5797711 - 5797657
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  5797711 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 5797657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 5827764 - 5827806
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||||||||| |||||||||    
T  5827764 gtccctgaccccacttttgtgatgatttgcatatgtggcacat 5827806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 9289368 - 9289427
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||| |||||||||||||||||||    ||||||||||||||||||||    
T  9289368 gaaaatagtcccttaccccaattttgtgatgatttgcata----gcacattataactgaaccaa 9289427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 13530488 - 13530542
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  13530488 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 13530542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 25424203 - 25424149
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  25424203 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 25424149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 25358460 - 25358407
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||||||||||| | ||||||||||| || |||||||    
T  25358460 gtccctgaccccacttttgtgatgatttgaacacgtggcacatgatgactgaac 25358407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 360
Target Start/End: Complemental strand, 29420436 - 29420387
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||| || ||||||||||||||||||| ||||||||||||||||    
T  29420436 gaaaatagtctctaaccccacttttgtgatgatatgcatacgtggcacat 29420387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 51738362 - 51738309
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || |||||||    
T  51738362 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaac 51738309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 47135887 - 47135942
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || |||||||||    
T  47135887 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacca 47135942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 4211610 - 4211652
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| |||||||||||    
T  4211610 gtccctggccccacttttgtgatgatttgcacacgtggcacat 4211652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 12791865 - 12791811
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||||||||||||||| ||||| ||||| || ||||||||    
T  12791865 gtccctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 12791811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 24774318 - 24774264
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  24774318 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 24774264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 36050395 - 36050449
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| ||||||||||||||||||||||| |||||||| || || ||||||||    
T  36050395 gtccctggccccacttttgtgatgatttgcacacgtggcatatgatgactgaacc 36050449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 54208716 - 54208662
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  54208716 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 54208662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 312 - 357
Target Start/End: Original strand, 11285605 - 11285650
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggca 357  Q
    ||||||||| ||||||||| |||||||||||||||||||| |||||    
T  11285605 aaaatagtctctgaccccatttttgtgatgatttgcatacatggca 11285650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 14488078 - 14488025
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||| ||| ||||||||||||||||| ||||||||||| || |||||||    
T  14488078 gtccctgacaccaattttgtgatgatttgcacacgtggcacatgatgactgaac 14488025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 323 - 372
Target Start/End: Original strand, 41439902 - 41439951
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| ||||||||||||||||||| ||||||||||| || ||||||||    
T  41439902 tgaccctacttttgtgatgatttgcacacgtggcacatgatgactgaacc 41439951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 316 - 348
Target Start/End: Complemental strand, 14791759 - 14791727
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgca 348  Q
    |||||||||||||||||||||||||||||||||    
T  14791759 tagtccctgaccccacttttgtgatgatttgca 14791727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 370
Target Start/End: Original strand, 29380717 - 29380769
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||| |||||||||||| |||||||||| ||||||||||| || ||||||    
T  29380717 gtccctggccccacttttgtaatgatttgcacacgtggcacatgatgactgaa 29380769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 360
Target Start/End: Original strand, 43368566 - 43368614
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||  |||||||| |||| ||||||||||||||||||||||||    
T  43368566 aaaatagtcgttgaccccatttttatgatgatttgcatacgtggcacat 43368614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 52441862 - 52441922
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||  |||||||| ||||||||||||||||||||||| ||| | || ||||||||    
T  52441862 aaaatagtctttgaccccatttttgtgatgatttgcatacgtgacacgtgatgactgaacc 52441922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 8191288 - 8191238
Alignment:
Q  312 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||| ||||    
T  8191288 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacat 8191238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 42848282 - 42848227
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
T  42848282 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 42848227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 328 - 370
Target Start/End: Complemental strand, 2034735 - 2034693
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||| ||||||||||| || ||||||    
T  2034735 ccacttttgtgatgatttgcacacgtggcacatgatgactgaa 2034693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 371
Target Start/End: Complemental strand, 28449123 - 28449065
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| | |||||||| |||||||||||||||||||| ||||| || || |||||||    
T  28449123 aaatagttcatgaccccatttttgtgatgatttgcatacatggcatatgatgactgaac 28449065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 35119380 - 35119426
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| |||||| |||| || ||||||||    
T  35119380 ccccacttttgtgatgatttgcacacgtggtacatgatgactgaacc 35119426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Complemental strand, 46115670 - 46115628
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  46115670 gtccctggctccacttttgtgatgatttgcacacgtggcacat 46115628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Complemental strand, 46128804 - 46128762
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| | ||||||||||||||||||||| |||||||||||    
T  46128804 gtccctggctccacttttgtgatgatttgcacacgtggcacat 46128762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 46292441 - 46292483
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| ||||| |||||    
T  46292441 gtccctgcccccacttttgtgatgatttgcacacgtgacacat 46292483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 47022996 - 47022942
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | |||||||| |||||||||||| ||||||||||| || ||||||||    
T  47022996 gtccctggctccacttttttgatgatttgcacacgtggcacatgatgactgaacc 47022942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 322 - 359
Target Start/End: Complemental strand, 12152380 - 12152343
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    |||||||||||||||||||||||||||  |||||||||    
T  12152380 ctgaccccacttttgtgatgatttgcactcgtggcaca 12152343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 50754146 - 50754094
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||||||| || ||||| ||||| || |||||||    
T  50754146 gtccctgaccccacttttgtgatgattt-cacacgtgacacatgatgactgaac 50754094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 321 - 373
Target Start/End: Original strand, 19321682 - 19321734
Alignment:
Q  321 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
T  19321682 cctgactccacttttgtgataatttgcacacgtgacacatgatgactgaacca 19321734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 318 - 374
Target Start/End: Original strand, 19903370 - 19903426
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||| || |||||||||||||||||||| | ||||||||| || | ||||||||    
T  19903370 gtccctggccacacttttgtgatgatttgcacatgtggcacatgatgagtgaaccaa 19903426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 318 - 370
Target Start/End: Complemental strand, 52543620 - 52543568
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||| ||||||||||||| |||||||||||| ||||| ||||| || ||||||    
T  52543620 gtccatgaccccacttttctgatgatttgcacacgtgtcacatgatgactgaa 52543568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 370
Target Start/End: Complemental strand, 54903359 - 54903315
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||||||||||||||||  |||| ||||| |||||||||    
T  54903359 ccccacttttgtgatgatttgcaagcgtgacacataataactgaa 54903315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 64; Significance: 8e-28; HSPs: 101)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 13584105 - 13584168
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13584105 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 13584168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 19656802 - 19656739
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19656802 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19656739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 22156031 - 22156094
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22156031 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 22156094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 37506968 - 37507031
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37506968 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 37507031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 275543 - 275606
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  275543 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 275606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 3152010 - 3151947
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3152010 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 3151947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 4950266 - 4950203
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4950266 gaaaataggccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 4950203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 8510316 - 8510379
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8510316 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 8510379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 10977079 - 10977142
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  10977079 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa 10977142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 20757500 - 20757563
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  20757500 gaaaatagtccctgaccccacttttgtgattatttgcatacgtggcacattataactgaaccaa 20757563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 20907356 - 20907293
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  20907356 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 20907293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 21159715 - 21159652
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  21159715 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 21159652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 39072112 - 39072049
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  39072112 gaaaatagtccctgaccccacttttgtgataatttgcatacgtggcacattataactgaaccaa 39072049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 39288798 - 39288735
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  39288798 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 39288735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 39437007 - 39436944
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  39437007 gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 39436944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 5345587 - 5345525
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  5345587 aaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5345525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 311 - 373
Target Start/End: Original strand, 47901901 - 47901963
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  47901901 gaaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaacca 47901963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 10778631 - 10778568
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||    
T  10778631 gaaaatagtccctgaccctacttttgtgatgatttgcatatgtggcacattataactgaaccaa 10778568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 12673904 - 12673841
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  12673904 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 12673841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 14633786 - 14633723
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  14633786 gaaaatagtccctaaccccacttttgtgaagatttgcatacgtggcacattataactgaaccaa 14633723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 16123242 - 16123305
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  16123242 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 16123305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 26799990 - 26800053
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  26799990 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 26800053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 28427507 - 28427444
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  28427507 gaaaatagtctctgaccccacttttgtgatgatttgcatacatggcacattataactgaaccaa 28427444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 29955400 - 29955463
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||    
T  29955400 gaaaatagtccctgaccccacttttgtgatgatttgcattcgtgtcacattataactgaaccaa 29955463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 30004554 - 30004617
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||    
T  30004554 gaaaatagtccctgaccccacttttgtgatgatttgcatgcgtgacacattataactgaaccaa 30004617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 34238699 - 34238762
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  34238699 gaaaatagtccctgactccacttttgagatgatttgcatacgtggcacattataactgaaccaa 34238762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 40169552 - 40169493
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  40169552 gaaaatagtccctgaccccacttttgtgatgattcgcatacgtggcacattataactgaa 40169493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 45161213 - 45161276
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||    
T  45161213 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 45161276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 45320879 - 45320816
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||    
T  45320879 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 45320816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 29446057 - 29446119
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
T  29446057 aaaatagtccctaaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 29446119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 51834841 - 51834778
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||    
T  51834841 gaaaatagtccctgaccccactattgtgatgatttgcatacgtgacacattataacggaaccaa 51834778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 18175889 - 18175951
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||    
T  18175889 aaaatagtccctgaccttatttttgtgatgatttgcatacgtggcacattataactgaaccaa 18175951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 313 - 371
Target Start/End: Complemental strand, 20612796 - 20612738
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  20612796 aaatagcccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaac 20612738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 3830232 - 3830292
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||    
T  3830232 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaac 3830292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 4513519 - 4513459
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  4513519 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 4513459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 7518346 - 7518287
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||    
T  7518346 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattataactgaa 7518287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 25710771 - 25710708
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||| |||||||||||||||| || |||||||||||||||||||||||||||    
T  25710771 gaaaatagtctctgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa 25710708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 30130258 - 30130321
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||| ||||||||||||||||||||||||||||| ||||||||| |||||||||    
T  30130258 gaaaatagtctctggccccacttttgtgatgatttgcatacgtgacacattatagctgaaccaa 30130321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 31869856 - 31869793
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||| |||||||||||||||| || |||||||||||||||||||||||||||    
T  31869856 gaaaatagtccatgactccacttttgtgatgatctgtatacgtggcacattataactgaaccaa 31869793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 323 - 374
Target Start/End: Complemental strand, 49670725 - 49670674
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  49670725 tgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 49670674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 360
Target Start/End: Complemental strand, 46186669 - 46186620
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
T  46186669 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 46186620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 318 - 374
Target Start/End: Complemental strand, 7957118 - 7957062
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||    
T  7957118 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa 7957062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 9863303 - 9863239
Alignment:
Q  311 gaaaatagtccctgaccccactttt-gtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||| ||||||||||||||||||| |||||||||| ||||||||    
T  9863303 gaaaatagtccctgacaccactttttgtgatgatttgcatacgtgacacattataattgaaccaa 9863239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 15016645 - 15016597
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
T  15016645 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 15016597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 360
Target Start/End: Original strand, 51759922 - 51759970
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
T  51759922 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 51759970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 50261839 - 50261777
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||| |||||||||||||||||||||| | ||||||||||||||||||||||    
T  50261839 gaaaatagtctctgactccacttttgtgatgatttgcatgc-tggcacattataactgaaccaa 50261777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 40277931 - 40277985
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || ||||||||    
T  40277931 gtccctgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40277985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 313 - 371
Target Start/End: Original strand, 50196401 - 50196459
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||| || |||||||    
T  50196401 aaatagtccctgaccctatttttgtgatgatttgcatacgtggcacatgatgactgaac 50196459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 4814799 - 4814751
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||| || |||||||||||||||||||||||||||||    
T  4814799 aaaatagtccctgacctcatttttgtgatgatttgcatacgtggcacat 4814751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 30268585 - 30268645
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||| |||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
T  30268585 aaaatagttcctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 30268645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 51500584 - 51500536
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||| ||||||||||||||||||||||| |||||    
T  51500584 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacat 51500536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 312 - 359
Target Start/End: Original strand, 28942627 - 28942674
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    ||||||||| |||| |||||||||||||||||||||||||||||||||    
T  28942627 aaaatagtctctgatcccacttttgtgatgatttgcatacgtggcaca 28942674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 4034826 - 4034880
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  4034826 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 4034880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 9262045 - 9261991
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  9262045 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 9261991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 320 - 374
Target Start/End: Complemental strand, 30426175 - 30426121
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||| ||| |||||||||||| ||||||    
T  30426175 ccctgaccccatttttgtgatgatttgcatatgtgacacattataactaaaccaa 30426121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 36673072 - 36673114
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||||||||||| ||||||||||||||    
T  36673072 gtccctgaccccacttttgtgatgatttacatacgtggcacat 36673114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 329 - 371
Target Start/End: Original strand, 40979479 - 40979521
Alignment:
Q  329 cacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||||| ||||||||||||||||    
T  40979479 cacttttgtgatgatttgcatacgtgtcacattataactgaac 40979521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 373
Target Start/End: Original strand, 45521650 - 45521712
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||| || | |||| |||| |||||||||||||||||| ||||||||||||||||||    
T  45521650 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca 45521712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 53701461 - 53701523
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||| || || |||||| ||||||||||||||||||||||||||||| || ||||||||||    
T  53701461 aaaataatctctaaccccatttttgtgatgatttgcatacgtggcacatgatgactgaaccaa 53701523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 15286402 - 15286354
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| |||| |||| |||||||||||||||||||||||||||||    
T  15286402 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat 15286354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 30552246 - 30552306
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||| | |||| |||||||||||||||||||||||| || ||||||||    
T  30552246 aaaatagtcactgaccctatttttatgatgatttgcatacgtggcacatgatgactgaacc 30552306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 318 - 370
Target Start/End: Complemental strand, 52342473 - 52342421
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||    
T  52342473 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaa 52342421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 321 - 372
Target Start/End: Original strand, 36732750 - 36732801
Alignment:
Q  321 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||||| | ||||||||| || ||||||||    
T  36732750 cctgaccccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 36732801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 313 - 372
Target Start/End: Complemental strand, 45313759 - 45313700
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||| ||||||||||||||||||||| ||| ||||| ||| || ||||||||    
T  45313759 aaatagtccctggccccacttttgtgatgatttgtatatgtggcgcatgatgactgaacc 45313700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 326 - 372
Target Start/End: Complemental strand, 2486785 - 2486739
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
T  2486785 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 2486739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 9596986 - 9596932
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||| ||||||||||||||||||||||| || ||||||||    
T  9596986 gtccctgtctccacttttgagatgatttgcatacgtggcacatgatgactgaacc 9596932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 20405110 - 20405060
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||| ||||||||||||||||||||||||||| ||||| || ||||||||    
T  20405110 ctgactccacttttgtgatgatttgcatacgtgacacatgatgactgaacc 20405060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 374
Target Start/End: Complemental strand, 30034353 - 30034307
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||||    
T  30034353 ccacttttgtgatgatttgcacacgtggcacatgatgactgaaccaa 30034307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 325 - 371
Target Start/End: Original strand, 35533393 - 35533439
Alignment:
Q  325 accccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||| ||||||||||| || |||||||    
T  35533393 accccacttttgtgatgatttgcacacgtggcacatgatgactgaac 35533439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 50009029 - 50009071
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||| |||||||||||||||||||||||||| |||||||||||    
T  50009029 gtccatgaccccacttttgtgatgatttgcacacgtggcacat 50009071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 322 - 372
Target Start/End: Original strand, 53113496 - 53113546
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||| || |||||||| || ||||||||    
T  53113496 ctgaccccacttttgtgatgatttgcacacatggcacatgatgactgaacc 53113546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 359
Target Start/End: Complemental strand, 8555199 - 8555158
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    ||||||||||||||||||||||||||||||| ||||| ||||    
T  8555199 gtccctgaccccacttttgtgatgatttgcacacgtgtcaca 8555158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 9603738 - 9603791
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||| ||||||||||||||||||||| ||||| ||||| || |||||||    
T  9603738 gtccctgactccacttttgtgatgatttgcacacgtgtcacatgatgactgaac 9603791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 321 - 370
Target Start/End: Original strand, 28418653 - 28418702
Alignment:
Q  321 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||| ||||||||||||||||||||||| ||||||||||| || ||||||    
T  28418653 cctggccccacttttgtgatgatttgcacacgtggcacatgatgactgaa 28418702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 316 - 372
Target Start/End: Complemental strand, 16679857 - 16679801
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||| || ||||||||||||||||| ||||||||||  || ||||||||    
T  16679857 tagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatgactgaacc 16679801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 35177374 - 35177418
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  35177374 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 35177418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 35565627 - 35565671
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  35565627 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 35565671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 43440614 - 43440654
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||| || ||||||||    
T  43440614 ttttgtgatgatttgcatacgtggcacatgatgactgaacc 43440654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 12741016 - 12741071
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  12741016 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 12741071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 22008781 - 22008726
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  22008781 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22008726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 22016299 - 22016244
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  22016299 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 22016244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 321 - 372
Target Start/End: Original strand, 35407551 - 35407602
Alignment:
Q  321 cctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||| | | ||||||||| || ||||||||    
T  35407551 cctgaccccacttttgtgatgatttgtacaggtggcacatgatgactgaacc 35407602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 45002130 - 45002185
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  45002130 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 45002185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 371
Target Start/End: Original strand, 46901203 - 46901261
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||| ||||||||||| || |||| |||||||||||||||||| ||||| ||||||||||    
T  46901203 aaaaaagtccctgacctcattttt-tgatgatttgcatacgtgacacatgataactgaac 46901261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 1721196 - 1721238
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| | |||||||||    
T  1721196 gtccctggccccacttttgtgatgatttgcacatgtggcacat 1721238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 20644614 - 20644656
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||| ||||||||||||||||||||||| | |||||||||    
T  20644614 gtccctggccccacttttgtgatgatttgcacatgtggcacat 20644656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 25610022 - 25609968
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| |||||||| |||||||||| | ||||||||||| || ||||||||    
T  25610022 gtccctgactccacttttctgatgatttgaacacgtggcacatgatgactgaacc 25609968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 31480391 - 31480337
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || ||||||||    
T  31480391 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacc 31480337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 45005995 - 45006049
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||| ||||| || ||||||||    
T  45005995 gtccctggctccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 45006049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 47114701 - 47114651
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| |||||||||||||||||||| ||||| ||||| || ||||||||    
T  47114701 ctgacctcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 47114651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 372
Target Start/End: Original strand, 54767284 - 54767334
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||  ||||| ||||| || ||||||||    
T  54767284 ctgaccccacttttgtgatgatttgctcacgtgacacatgatgactgaacc 54767334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 373
Target Start/End: Complemental strand, 8940406 - 8940361
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  8940406 ccacttttgtgataatttgcacacgtggcacatgatgactgaacca 8940361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 326 - 359
Target Start/End: Complemental strand, 29678270 - 29678237
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcaca 359  Q
    ||||||||||||||||||||||| ||||||||||    
T  29678270 ccccacttttgtgatgatttgcacacgtggcaca 29678237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 372
Target Start/End: Complemental strand, 38232498 - 38232445
Alignment:
Q  319 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| |||||||||||||||||| | ||||| ||||| || ||||||||    
T  38232498 tccctgacctcacttttgtgatgatttgtacacgtgacacatgatgactgaacc 38232445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 39132798 - 39132745
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| ||||||||||||||||||||||| ||||| | ||| || |||||||    
T  39132798 gtccctggccccacttttgtgatgatttgcacacgtgacgcatgatgactgaac 39132745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 372
Target Start/End: Complemental strand, 11463362 - 11463318
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||| |||||||||||| ||||||||||| || ||||||||    
T  11463362 ccacttttttgatgatttgcacacgtggcacatgatgactgaacc 11463318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 320 - 360
Target Start/End: Original strand, 14772323 - 14772363
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||| |||||||||||||||||||||| | |||||||||||    
T  14772323 cccttaccccacttttgtgatgatttgtacacgtggcacat 14772363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 318 - 354
Target Start/End: Original strand, 27681426 - 27681462
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtg 354  Q
    |||||||| |||||||||||||||||||||| |||||    
T  27681426 gtccctgatcccacttttgtgatgatttgcacacgtg 27681462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 372
Target Start/End: Complemental strand, 40370465 - 40370425
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||| ||||||||||| || ||||||||    
T  40370465 ttttgtgatgatttgcacacgtggcacatgatgactgaacc 40370425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 329 - 373
Target Start/End: Complemental strand, 49324026 - 49323982
Alignment:
Q  329 cacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||||| ||||||| ||||||||||| || |||||||||    
T  49324026 cacttttgtgataatttgcacacgtggcacatgatgactgaacca 49323982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 323 - 371
Target Start/End: Original strand, 51058703 - 51058751
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||| ||||||||||||||||||||||| ||| ||||| || |||||||    
T  51058703 tgactccacttttgtgatgatttgcatatgtgacacatgatgactgaac 51058751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 64; Significance: 8e-28; HSPs: 74)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 19183884 - 19183947
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19183884 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 19183947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 23989937 - 23990000
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23989937 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 23990000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 26814127 - 26814064
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26814127 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 26814064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 38980152 - 38980089
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38980152 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 38980089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 3838162 - 3838099
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  3838162 gaaaatagtccctgacaccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 3838099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 5790797 - 5790734
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5790797 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5790734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 24483632 - 24483695
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  24483632 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24483695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 37272001 - 37271938
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37272001 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 37271938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 40302077 - 40302140
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  40302077 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactcaaccaa 40302140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 17541674 - 17541612
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  17541674 aaaatagtccctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 17541612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 38731929 - 38731991
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  38731929 aaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 38731991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 16899996 - 16900056
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16899996 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 16900056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 16993387 - 16993447
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16993387 gaaaataatccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 16993447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 43710480 - 43710540
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  43710480 gaaaatagtccctgacctcacttttgtgatgatttgcatacgtggcacattataactgaac 43710540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 7814505 - 7814442
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  7814505 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa 7814442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 7814638 - 7814575
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  7814638 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacattataactgaaccaa 7814575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 8046430 - 8046493
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  8046430 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 8046493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 12835427 - 12835490
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||    
T  12835427 gaaaatagtccctgaccctacttttgtgatgatttgcatacgtggcacattataacggaaccaa 12835490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 26238912 - 26238975
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  26238912 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacataataactgaaccaa 26238975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 41693901 - 41693838
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||    
T  41693901 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattacaactgaaccaa 41693838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 41791119 - 41791178
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  41791119 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaa 41791178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 43789090 - 43789027
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||    
T  43789090 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcatattatcactgaaccaa 43789027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 44985722 - 44985785
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
T  44985722 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacgttataactgaaccaa 44985785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 311 - 371
Target Start/End: Complemental strand, 14393029 - 14392969
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||    
T  14393029 gaaaatagtccctgaccccacttttgtgatgatttgtatatgtggcacattataactgaac 14392969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 20658160 - 20658223
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||    
T  20658160 gaaaataatccctgactccacttttgtgattatttgcatacgtggcacattataactgaaccaa 20658223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 22881869 - 22881806
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  22881869 gaaaatagtccctaaccccacttttgtgatgatttgcatacgtgtcacattataactaaaccaa 22881806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 33732960 - 33733023
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
T  33732960 gaaaatagttcctgaccctacttttatgatgatttgcatacgtggcacattataactgaaccaa 33733023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 40786561 - 40786624
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||    
T  40786561 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 40786624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 24483500 - 24483562
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  24483500 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgtcacatgataactgaaccaa 24483562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 311 - 371
Target Start/End: Original strand, 26707972 - 26708032
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||||||||||  ||||||||||||||||||||||||||| ||||||||||||||||    
T  26707972 gaaaatagtccctgaatccacttttgtgatgatttgcatacgtgacacattataactgaac 26708032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1497843 - 1497780
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||   ||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  1497843 gaaaatagtccacaaccccacttttgtgatgatttgcatacgtggtacattataactgaaccaa 1497780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 10665084 - 10665143
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||    
T  10665084 gaaaatagtctctgaccccacttttgtgatgatttacatacgtggtacattataactgaa 10665143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 11713743 - 11713680
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||||||| ||| ||||    
T  11713743 gaaaatagtccctgacccaacttttgtggtgatttgcatacgtggcacattataattgagccaa 11713680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 25954325 - 25954262
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| || ||||||||||||||||||||||||||  |||||||||||||||||||    
T  25954325 gaaaatagtccctaactccacttttgtgatgatttgcatacgtaacacattataactgaaccaa 25954262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 31225817 - 31225879
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||    
T  31225817 gaaaatagtccttgaccccacttttgtgatgatttgca-acgtgacacattataactgaaccaa 31225879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 44073705 - 44073642
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||    
T  44073705 gaaaatagtccctgacctcacttttgtgataatttgcatacgtgacacattataaccgaaccaa 44073642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 43592146 - 43592195
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
T  43592146 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 43592195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 372
Target Start/End: Complemental strand, 43597400 - 43597339
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
T  43597400 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 43597339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 17912550 - 17912614
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgat-gatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||| || ||||||||| | |||||||||||||||||||    
T  17912550 gaaaatagtccctgaccccacttttgtgatagacttgcatacgggacacattataactgaaccaa 17912614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 45442415 - 45442475
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||| || ||||||||    
T  45442415 aaaatagtccctgaccccatttttgtgattatttgcatacgtggcacatgatgactgaacc 45442475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 32691413 - 32691474
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||| | || ||||||||    
T  32691413 gaaaatggtccctgaccccatttttgtgatgatttgcatacgtggcacgtgatgactgaacc 32691474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 31326149 - 31326101
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||    
T  31326149 aaaatagtcgctgaccccatttttgtgatgatttgcatacgtggcacat 31326101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 311 - 373
Target Start/End: Complemental strand, 19831694 - 19831632
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||| || | |||| |||| |||||||||||||||||| ||||||||||||||||||    
T  19831694 gaaaatagtcacttatcccatttttttgatgatttgcatacgtgacacattataactgaacca 19831632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 20939216 - 20939162
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||||||||||| || ||||||||||| || ||||||||    
T  20939216 gtccctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaacc 20939162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 23732220 - 23732166
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| ||||||||||| || ||||||||    
T  23732220 gtccctgactccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 23732166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Original strand, 1138091 - 1138144
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||| ||||||||||||||||||||||||| ||||||||||| || |||||||    
T  1138091 gtccccgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 1138144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 25750857 - 25750804
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||| |||||||||||||||||||||||||| ||||||||||| || |||||||    
T  25750857 gtccttgaccccacttttgtgatgatttgcacacgtggcacatgatgactgaac 25750804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 44993957 - 44993909
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| |||| |||| |||||||||||||||||||||||||||||    
T  44993957 aaaatagtctctgatcccatttttgtgatgatttgcatacgtggcacat 44993909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 29865411 - 29865348
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| || |||  ||||||||||||||||||||||||| |||||||  ||||||||||    
T  29865411 gaaaatagtctctaaccaaacttttgtgatgatttgcatacgtgacacattaatactgaaccaa 29865348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 4424004 - 4424058
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  4424004 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 4424058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 4842940 - 4842994
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| |||||||||||||||||| || ||||||||||| || ||||||||    
T  4842940 gtccctgactccacttttgtgatgattttcacacgtggcacatgatgactgaacc 4842994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 16523098 - 16523152
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  16523098 gtccctggcgccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 16523152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 27109151 - 27109205
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  27109151 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 27109205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 31909370 - 31909316
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| ||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  31909370 gtccctggccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 31909316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 40125075 - 40125129
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  40125075 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 40125129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 43672041 - 43672095
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| ||||||||||||||| ||||||| ||||||||||| || ||||||||    
T  43672041 gtccctggccccacttttgtgattatttgcacacgtggcacatgatgactgaacc 43672095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 319 - 371
Target Start/End: Complemental strand, 1295437 - 1295385
Alignment:
Q  319 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    |||||||| ||||||||||||||||||||| | ||||||||| || |||||||    
T  1295437 tccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaac 1295385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 10374972 - 10374913
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggc-acattataactgaaccaa 374  Q
    ||||||||||||||||||     ||||||| ||||||||||||||| ||||||||||||||||||    
T  10374972 gaaaatagtccctgaccc-----ttgtgataatttgcatacgtggccacattataactgaaccaa 10374913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 2481302 - 2481357
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  2481302 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 2481357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 351
Target Start/End: Original strand, 36622349 - 36622388
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatac 351  Q
    |||||||||| |||||||| ||||||||||||||||||||    
T  36622349 aaaatagtccatgaccccatttttgtgatgatttgcatac 36622388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 41451946 - 41452001
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  41451946 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 41452001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 1696230 - 1696284
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||||||||||||  | ||||||||||| || ||||||||    
T  1696230 gtccctgacctcacttttgtgatgatttaaacacgtggcacatgatgactgaacc 1696284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 3832388 - 3832434
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  3832388 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 3832434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 4042781 - 4042727
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||  |||||||||||||||||||| ||||| ||||| || ||||||||    
T  4042781 gtccctgacttcacttttgtgatgatttgcacacgtgacacatgatgactgaacc 4042727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 10671739 - 10671793
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | |||||||| |||||||||||| ||||||||||| || ||||||||    
T  10671739 gtccctggctccacttttctgatgatttgcacacgtggcacatgatgactgaacc 10671793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 29182277 - 29182319
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||||||||||||||| ||||| |||||    
T  29182277 gtccctgactccacttttgtgatgatttgcacacgtgacacat 29182319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 34317915 - 34317961
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  34317915 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 34317961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Complemental strand, 35686224 - 35686178
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| |||| |||||| || ||||||||    
T  35686224 ccccacttttgtgatgatttgcacacgtagcacatgatgactgaacc 35686178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 348
Target Start/End: Original strand, 37228831 - 37228861
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgca 348  Q
    |||||||||||||||||||||||||||||||    
T  37228831 gtccctgaccccacttttgtgatgatttgca 37228861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 37911011 - 37910957
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| | |||||| || || ||||||||    
T  37911011 gtccctgactccacttttgtgatgatttgcacatgtggcatatgatgactgaacc 37910957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 372
Target Start/End: Complemental strand, 13215311 - 13215262
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||| |||||||||||| | ||||||||| || ||||||||    
T  13215311 tgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacc 13215262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 372
Target Start/End: Complemental strand, 44559299 - 44559246
Alignment:
Q  319 tccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||| |||||||| |||||||||||| ||||| ||||| || ||||||||    
T  44559299 tccctgactccacttttctgatgatttgcacacgtgacacatgatgactgaacc 44559246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 324 - 360
Target Start/End: Original strand, 13850635 - 13850671
Alignment:
Q  324 gaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||| ||||| |||||    
T  13850635 gaccccacttttgtgatgatttgcacacgtgacacat 13850671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 370
Target Start/End: Original strand, 38231544 - 38231592
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||| ||||||| | ||||||||| || ||||||    
T  38231544 ctgaccccacttttgtgataatttgcacatgtggcacatgatgactgaa 38231592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 8e-28; HSPs: 91)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 990188 - 990251
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  990188 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 990251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 12361112 - 12361175
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12361112 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 12361175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 18473373 - 18473436
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18473373 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18473436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 41358562 - 41358499
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41358562 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 41358499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 3679725 - 3679788
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  3679725 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 3679788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 4323930 - 4323993
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  4323930 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 4323993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 7001795 - 7001732
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  7001795 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 7001732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 15335193 - 15335130
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  15335193 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 15335130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 31258441 - 31258504
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  31258441 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 31258504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 32728948 - 32728885
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32728948 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 32728885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 48955964 - 48955901
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48955964 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 48955901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 24649452 - 24649514
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24649452 aaaatagtctctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 24649514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 312 - 373
Target Start/End: Complemental strand, 29688330 - 29688269
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29688330 aaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 29688269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 2733285 - 2733348
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  2733285 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 2733348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 13260087 - 13260150
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  13260087 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 13260150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 14007588 - 14007647
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  14007588 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaa 14007647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 19622757 - 19622820
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  19622757 gaaaatagtccatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 19622820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 32454189 - 32454126
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
T  32454189 gaaaatagtccctgaccccacttttatgatgatttgcatacgtgacacattataactgaaccaa 32454126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 32626792 - 32626729
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||    
T  32626792 gaaaatagtccctgaccccacttttgtgatgatttacatacgtggcacaatataactgaaccaa 32626729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35308009 - 35307946
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||    
T  35308009 gaaaatagtccctgacaccacttttgcgatgatttgcatacgtggcacattataactgaaccaa 35307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 41881195 - 41881258
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
T  41881195 gaaaatagtccctgaccccacttttgtgatgatttgcatatgtggcacattataacttaaccaa 41881258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 44641333 - 44641271
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  44641333 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtggcacattataactgaaccaa 44641271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 18302281 - 18302219
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  18302281 aaaatagtctctgactccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 18302219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 45290559 - 45290621
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  45290559 aaaatagtctctgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 45290621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1159739 - 1159676
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||    
T  1159739 gaaaatagtccctgaccccacttttatgatgatttgcatatgtggcacgttataactgaaccaa 1159676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 10552212 - 10552149
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  10552212 gaaaatagtttctgaccccacttttgtgatgatttgcatacgtggcacattataacttaaccaa 10552149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 17984595 - 17984532
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  17984595 gaaaatagttcatgaccccacttttgtgatgatttgcatacgtgacacattataactgaaccaa 17984532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 21383203 - 21383266
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||    
T  21383203 gaaaatagtccctaaccccacttttgtgattatttgcatatgtggcacattataactgaaccaa 21383266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 21391276 - 21391214
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||    
T  21391276 gaaaatagtccctgaccc-acttttgtgatgatttgcatacgtgacacattataactgaaccaa 21391214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 370
Target Start/End: Original strand, 26062058 - 26062117
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
T  26062058 gaaaatagtacatgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 26062117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 4360370 - 4360432
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||    
T  4360370 aaaatagtccctgaccgcacttttgtgctgatttgcatacgtggcgcattataactgaaccaa 4360432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 316 - 374
Target Start/End: Original strand, 35005491 - 35005549
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
T  35005491 tagtccctgaccctagttttgtgatgatttgcatacgtggcacattataactgaaccaa 35005549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 22919783 - 22919844
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  22919783 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 22919844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 26191459 - 26191520
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  26191459 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 26191520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 18900033 - 18899973
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  18900033 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 18899973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 33067629 - 33067569
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||    
T  33067629 aaaatagtccctgaccccacctttgtgatgatttgcatacgtggcacatgatgactgaacc 33067569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 7819001 - 7818938
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||  | | |||||||||||||||||||||||||||||||||||||||||    
T  7819001 gaaaatagtccctgaccatattcttgtgatgatttgcatacgtggcacattataactgaaccaa 7818938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 34383047 - 34383110
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||  |||||||||||||||||||||||||||||||| |||||||||||| ||||||    
T  34383047 gaaaatagtcattgaccccacttttgtgatgatttgcatacgtgacacattataacttaaccaa 34383110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 312 - 374
Target Start/End: Original strand, 33379989 - 33380051
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| || || |||||||    
T  33379989 aaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacatgatgaccgaaccaa 33380051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 311 - 373
Target Start/End: Complemental strand, 50429108 - 50429047
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||    
T  50429108 gaaaatagtccctgaccccacttt-gtgatgatttgcttacgtgacacattataactgaacca 50429047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 13770590 - 13770639
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
T  13770590 gaaaatagtccctgaccccatttttgtgatgatttgcatacgtggcacat 13770639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 16083154 - 16083214
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||| || ||||||||    
T  16083154 aaaatagtccctggccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 16083214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 46868329 - 46868389
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||    
T  46868329 aaaatagtccctgaccccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 46868389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 372
Target Start/End: Complemental strand, 1811170 - 1811109
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||| ||| ||||||||||||||||||||||| ||||| || ||||||||    
T  1811170 gaaaatagtccctgactccatttttgtgatgatttgcatacgtgacacatgatgactgaacc 1811109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 11822104 - 11822165
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||| ||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  11822104 gaaagtagtctctgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 11822165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 311 - 360
Target Start/End: Original strand, 20756120 - 20756169
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||||||| | |||||||||||||||||||||||||||||    
T  20756120 gaaaatagtccctgaccctatttttgtgatgatttgcatacgtggcacat 20756169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 26442797 - 26442736
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||  || ||||||||||||||||||||||| ||| |||||||||||||||||||    
T  26442797 gaaaatagtccc--acaccacttttgtgatgatttgcatatgtgacacattataactgaaccaa 26442736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 34808296 - 34808356
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||  |||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  34808296 aaaatagtcaatgaccccatttttgtgatgatttgcatacgtggcacataatgactgaacc 34808356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 48609493 - 48609445
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||    
T  48609493 aaaatagtctctgaccccatttttgtgatgatttgcatacgtggcacat 48609445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 52254283 - 52254343
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||| |||| | |||||||||||||||||||||| || ||||||||    
T  52254283 aaaatagtccctgaccccatttttattatgatttgcatacgtggcacatgatgactgaacc 52254343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 312 - 359
Target Start/End: Original strand, 29072600 - 29072647
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    ||||||||||||||||||| ||||||||||||| ||||||||||||||    
T  29072600 aaaatagtccctgaccccatttttgtgatgattcgcatacgtggcaca 29072647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 335 - 374
Target Start/End: Original strand, 49226361 - 49226400
Alignment:
Q  335 tgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  49226361 tgtgatgatttgcatacgtggcacattataactgaaccaa 49226400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 19198836 - 19198786
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||| ||||||||||| ||||| |||||    
T  19198836 ctgaccccacttttgtgatgatttgcacacgtggcacatgataacggaacc 19198786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 24510051 - 24510105
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||| | ||||||||| || ||||||||    
T  24510051 gtccctgaccccacttttgtgatgatttgcagatgtggcacatgatgactgaacc 24510105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 48730509 - 48730455
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || ||||||||    
T  48730509 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaacc 48730455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 318 - 371
Target Start/End: Complemental strand, 8364867 - 8364814
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||||||||||||||| ||||| ||||| || |||||||    
T  8364867 gtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgactgaac 8364814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 313 - 374
Target Start/End: Complemental strand, 22953454 - 22953393
Alignment:
Q  313 aaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| ||| |||||||||||||||| |||||||| || ||||||||| ||||||    
T  22953454 aaatagtccctggccctacttttgtgatgatttacatacgtgacatattataacttaaccaa 22953393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 322 - 374
Target Start/End: Original strand, 18927890 - 18927942
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||| || ||||||||||| || ||||||||||    
T  18927890 ctgaccccacttttgtgatgatttacacacgtggcacatgatgactgaaccaa 18927942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 311 - 347
Target Start/End: Original strand, 26142521 - 26142557
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgc 347  Q
    |||||||||||||||||||||||||||||||||||||    
T  26142521 gaaaatagtccctgaccccacttttgtgatgatttgc 26142557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Original strand, 27521676 - 27521724
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||| | || |||||||||||||||||||||||||||||    
T  27521676 aaaatagtccctgatctcatttttgtgatgatttgcatacgtggcacat 27521724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 37545850 - 37545790
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||| ||||||| ||||||||| ||||||||||||| ||||| || ||||||||    
T  37545850 aaaatagtccccgaccccatttttgtgataatttgcatacgtgccacatgatgactgaacc 37545790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 312 - 359
Target Start/End: Complemental strand, 45368749 - 45368702
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    ||||||||||||||||||| ||||||||||||||||||| ||| ||||    
T  45368749 aaaatagtccctgaccccatttttgtgatgatttgcatatgtgtcaca 45368702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 4789417 - 4789471
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||||||||  | ||||||||||| || ||||||||    
T  4789417 gtccctgaccccacttttgtgatgatttaaacacgtggcacatgatgactgaacc 4789471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 10887342 - 10887396
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  10887342 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 10887396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Original strand, 12360712 - 12360754
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||||||| | |||||||||    
T  12360712 gtccctgaccccacttttgtgatgatttgcacatgtggcacat 12360754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 16060704 - 16060758
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||||||||    
T  16060704 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 16060758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Complemental strand, 17129975 - 17129921
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| |||||||| || || ||||||||    
T  17129975 gtccctgactccacttttgtgatgatttgcacacgtggcagatgatgactgaacc 17129921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 18079516 - 18079562
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
T  18079516 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 18079562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 323 - 373
Target Start/End: Complemental strand, 42483217 - 42483167
Alignment:
Q  323 tgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    |||||||||||||||||||||||||| ||||| ||||| || |||||||||    
T  42483217 tgaccccacttttgtgatgatttgcacacgtgtcacatgatgactgaacca 42483167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 360
Target Start/End: Complemental strand, 49073944 - 49073902
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||||||||||| ||||| |||||    
T  49073944 gtccctgaccccacttttgtgatgatttgcacacgtgtcacat 49073902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 320 - 357
Target Start/End: Original strand, 32420208 - 32420245
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggca 357  Q
    ||||||||||||||||||||||||||||| ||||||||    
T  32420208 ccctgaccccacttttgtgatgatttgcacacgtggca 32420245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 3753312 - 3753372
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||| |||| |||||||| ||||||||||||||||||||||||  ||| || ||||||||    
T  3753312 aaaatggtccttgaccccatttttgtgatgatttgcatacgtggtgcatgatgactgaacc 3753372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 322 - 374
Target Start/End: Original strand, 12322718 - 12322770
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| |||||||||||| | ||||||||| |||| ||||||||    
T  12322718 ctgaccccacttttatgatgatttgcacatgtggcacatgataattgaaccaa 12322770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 370
Target Start/End: Complemental strand, 19720965 - 19720913
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||| ||||||||||||| ||||||| ||||||||||| || ||||||    
T  19720965 gtccctgactccacttttgtgataatttgcacacgtggcacatgatgactgaa 19720913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 24977898 - 24977942
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||| ||||||||||| || ||||||||    
T  24977898 ccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 24977942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 311 - 354
Target Start/End: Original strand, 292959 - 293002
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtg 354  Q
    ||||||||||| |  |||||||||||||||||||||||||||||    
T  292959 gaaaatagtccatagccccacttttgtgatgatttgcatacgtg 293002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 10631419 - 10631364
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||| ||||||| ||||| ||||| || |||||||||    
T  10631419 gtccctgactccacttttgtgataatttgcacacgtgtcacatgatgactgaacca 10631364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 16026829 - 16026774
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  16026829 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 16026774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 369
Target Start/End: Complemental strand, 26324838 - 26324787
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactga 369  Q
    ||||||||||||||||||||||||||||||| || || ||||| || |||||    
T  26324838 gtccctgaccccacttttgtgatgatttgcacacatgtcacataatgactga 26324787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 33000560 - 33000505
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  33000560 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 33000505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Original strand, 38150957 - 38151012
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||| | ||||||||||||| ||||||| ||||||||||| || |||||||||    
T  38150957 gtccctggctccacttttgtgataatttgcacacgtggcacatgatgactgaacca 38151012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 372
Target Start/End: Original strand, 5058838 - 5058888
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||| |||||||||||| | ||||||||| || ||||||||    
T  5058838 ctgaccccacttttatgatgatttgcacatgtggcacatgatgactgaacc 5058888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 360
Target Start/End: Original strand, 15466249 - 15466283
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||||| |||||||||||    
T  15466249 ccccacttttgtgatgatttgcacacgtggcacat 15466283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 370
Target Start/End: Complemental strand, 39303874 - 39303836
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||||||||||| || ||||||    
T  39303874 ttttgtgatgatttgcatacgtggcacatgatgactgaa 39303836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 41738913 - 41738959
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||| |||||||||| ||||||||||| || ||||||||    
T  41738913 ccccacttttgtaatgatttgcacacgtggcacatgatgactgaacc 41738959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 325 - 374
Target Start/End: Original strand, 34002691 - 34002740
Alignment:
Q  325 accccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| |||||||| ||||||||||| || ||||| ||||    
T  34002691 accccacttttgtgacgatttgcacacgtggcacatgatgactgagccaa 34002740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 360
Target Start/End: Original strand, 33045475 - 33045507
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||| |||||||||||    
T  33045475 ccacttttgtgatgatttgcacacgtggcacat 33045507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 360
Target Start/End: Original strand, 39747592 - 39747624
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||| |||||||||||    
T  39747592 ccacttttgtgatgatttgcacacgtggcacat 39747624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 360
Target Start/End: Complemental strand, 44157923 - 44157891
Alignment:
Q  328 ccacttttgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||| |||||||||||    
T  44157923 ccacttttgtgatgatttgcacacgtggcacat 44157891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 332 - 372
Target Start/End: Original strand, 46183812 - 46183852
Alignment:
Q  332 ttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||| ||||||||||| || ||||||||    
T  46183812 ttttgtgatgatttgcacacgtggcacatgatgactgaacc 46183852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 370
Target Start/End: Complemental strand, 51986459 - 51986415
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    ||||||||||||||||||||||| ||||| ||||| || ||||||    
T  51986459 ccccacttttgtgatgatttgcacacgtgacacatgatgactgaa 51986415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 5311 - 5374
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5311 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 5331 - 5394
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5331 gaaaatagtcactgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 5394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 8649 - 8712
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8649 gaaaatagtccctgatcccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 8712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0210 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0210
Description:

Target: scaffold0210; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 14797 - 14860
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  14797 gaaaatagtccctggccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 14860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 35170 - 35107
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35170 gaaaatagtccttgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 35107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 12284 - 12347
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  12284 gaaaatagtccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 12347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0811 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0811
Description:

Target: scaffold0811; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 1542 - 1479
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  1542 gaaaatagtctctgaccccacttttgtgatgatttgcatatgtggcacattataactgaaccaa 1479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0535 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0535
Description:

Target: scaffold0535; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 8926 - 8864
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  8926 gaaaatagtccctgaccccacttt-gtgatgatttgcatacgtggcacattataactgaaccaa 8864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 17942 - 17879
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
T  17942 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgtcactttataactgaaccaa 17879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 5605 - 5542
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  5605 gaaaatagtccccgaccccacgtttgtgatgatttgcatacgtggcacattataactgaaccaa 5542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 311 - 374
Target Start/End: Original strand, 10257 - 10320
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||    
T  10257 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtgacacattataattgaaccaa 10320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 312 - 374
Target Start/End: Complemental strand, 4211 - 4149
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  4211 aaaatagaccctgaccccacttttgtgatgatttgtatacgtggcacattataactgaaccaa 4149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 311 - 370
Target Start/End: Complemental strand, 3191 - 3132
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaa 370  Q
    |||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||    
T  3191 gaaaatagtctctgaccccacttttgtgatgatttgcatacgtggtacattataactgaa 3132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 311 - 372
Target Start/End: Original strand, 8432 - 8493
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||| || ||||||||    
T  8432 gaaaatagtccctgaccccatttttgtgatgatttgcatatgtggcacatgatgactgaacc 8493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 312 - 372
Target Start/End: Original strand, 94160 - 94220
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||| || ||||||||    
T  94160 aaaatagtccttgaccccatttttgtgatgatttgcatacgtggcacatgatgactgaacc 94220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 312 - 372
Target Start/End: Complemental strand, 366174 - 366114
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||| ||||||| ||||||||||||||| ||||||||||||| || ||||||||    
T  366174 aaaatagtccccgaccccatttttgtgatgatttgtatacgtggcacatgatgactgaacc 366114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0326
Description:

Target: scaffold0326; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 320 - 367
Target Start/End: Original strand, 4128 - 4175
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggcacattataact 367  Q
    |||||||||||||| || ||||||||||||||||||||||||||||||    
T  4128 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 4175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0326; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 320 - 367
Target Start/End: Original strand, 19310 - 19357
Alignment:
Q  320 ccctgaccccacttttgtgatgatttgcatacgtggcacattataact 367  Q
    |||||||||||||| || ||||||||||||||||||||||||||||||    
T  19310 ccctgaccccacttctgggatgatttgcatacgtggcacattataact 19357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0166 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0166
Description:

Target: scaffold0166; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 311 - 374
Target Start/End: Complemental strand, 24558 - 24495
Alignment:
Q  311 gaaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    |||||||||| |||||||  || ||||||||||||||||||||||| ||||||| |||||||||    
T  24558 gaaaatagtctctgaccctgctgttgtgatgatttgcatacgtggcgcattatatctgaaccaa 24495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1001 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold1001
Description:

Target: scaffold1001; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 312 - 359
Target Start/End: Original strand, 2878 - 2925
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcaca 359  Q
    |||||||||| |||||||| ||||||||||||||| ||||||||||||    
T  2878 aaaatagtccttgaccccatttttgtgatgatttgtatacgtggcaca 2925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0684 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0684
Description:

Target: scaffold0684; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 326 - 372
Target Start/End: Original strand, 2412 - 2458
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||||||||||||||||| ||||||||||| || ||||||||    
T  2412 ccccacttttgtgatgatttgcacacgtggcacatgatgactgaacc 2458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 372
Target Start/End: Original strand, 16832 - 16886
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    ||||||||| ||||||||||||||||||||| | ||||||||| || ||||||||    
T  16832 gtccctgactccacttttgtgatgatttgcacatgtggcacatgatgactgaacc 16886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 322 - 371
Target Start/End: Original strand, 2615 - 2664
Alignment:
Q  322 ctgaccccacttttgtgatgatttgcatacgtggcacattataactgaac 371  Q
    ||||||||||||||||||| ||||||| ||||||||||| || |||||||    
T  2615 ctgaccccacttttgtgattatttgcacacgtggcacatgatgactgaac 2664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0065 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0065
Description:

Target: scaffold0065; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 3818 - 3770
Alignment:
Q  312 aaaatagtccctgaccccacttttgtgatgatttgcatacgtggcacat 360  Q
    |||||||||||||| | || |||||| ||||||||||||||||||||||    
T  3818 aaaatagtccctgatctcatttttgttatgatttgcatacgtggcacat 3770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 318 - 374
Target Start/End: Original strand, 82450 - 82506
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaaccaa 374  Q
    ||||||| | ||||||||||||||||||||| ||||||||||| || ||| ||||||    
T  82450 gtccctggctccacttttgtgatgatttgcacacgtggcacatgatgactaaaccaa 82506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 316 - 348
Target Start/End: Original strand, 47972 - 48004
Alignment:
Q  316 tagtccctgaccccacttttgtgatgatttgca 348  Q
    |||||||||||||||||||||||||||||||||    
T  47972 tagtccctgaccccacttttgtgatgatttgca 48004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0105 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0105
Description:

Target: scaffold0105; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 17863 - 17813
Alignment:
Q  312 aaaatagtccctgaccccacttt--tgtgatgatttgcatacgtggcacat 360  Q
    ||||||||||||||||||||| |  ||||||||||||||||||||| ||||    
T  17863 aaaatagtccctgaccccactatattgtgatgatttgcatacgtggtacat 17813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 49969 - 49914
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||| |||||||  |||||||||| || |||||||||    
T  49969 gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca 49914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 373
Target Start/End: Complemental strand, 55070 - 55015
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggcacattataactgaacca 373  Q
    ||||||||| ||||||||||||| |||||||  |||||||||| || |||||||||    
T  55070 gtccctgactccacttttgtgataatttgcacgcgtggcacatgatgactgaacca 55015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 357
Target Start/End: Original strand, 189437 - 189476
Alignment:
Q  318 gtccctgaccccacttttgtgatgatttgcatacgtggca 357  Q
    ||||||| ||||||||||||||||||||||| ||||||||    
T  189437 gtccctggccccacttttgtgatgatttgcacacgtggca 189476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 372
Target Start/End: Original strand, 148007 - 148050
Alignment:
Q  329 cacttttgtgatgatttgcatacgtggcacattataactgaacc 372  Q
    |||||||||||||||||||| ||||||||||| || ||||||||    
T  148007 cacttttgtgatgatttgcacacgtggcacatgatgactgaacc 148050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0176 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0176
Description:

Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 326 - 358
Target Start/End: Original strand, 21807 - 21839
Alignment:
Q  326 ccccacttttgtgatgatttgcatacgtggcac 358  Q
    ||||||||||||||||||||||| |||||||||    
T  21807 ccccacttttgtgatgatttgcacacgtggcac 21839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University