View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11834_high_19 (Length: 248)
Name: NF11834_high_19
Description: NF11834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11834_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 55187570 - 55187324
Alignment:
| Q |
1 |
tgctgtgtttctcactttcttgttatgccatttttacagagcacgccatgtttattacttgaagtaaaactgtctgccaatctataagtcttacattggt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55187570 |
tgctgggtttctcactttcttgttatgccatttttacagagcacgccatgtttattactagaagtaaaactgtctgccaatctataagtcttacattggt |
55187471 |
T |
 |
| Q |
101 |
ctttttt-atacaaaactttgaaatggaaagctcaatcttgtttttaggtgccagtttaagggaatatacaaagattaatactgttttattacttttgta |
199 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55187470 |
ctttttttatacaaaactttgaaatggaaagctcaatcttgtttttaggtgccagtttaagggaatatacaaagattaatattgttttattacttttgta |
55187371 |
T |
 |
| Q |
200 |
aagtttcctttatgtcccaggattgttattctgtctctgcttctcca |
246 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
55187370 |
aagtttcctttatttcccaggattgttattctgtttctgtttctcca |
55187324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University