View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11834_low_14 (Length: 348)
Name: NF11834_low_14
Description: NF11834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11834_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 190 - 327
Target Start/End: Original strand, 39179312 - 39179449
Alignment:
| Q |
190 |
gccttactgtctttaggatttagatgacacatgattctgcatacattacattgtagtcttagctcatatgaaaatgggtattaaggcatgctatttttca |
289 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39179312 |
gccttactgtctttaggatttacaagacacatgattctgcatacattacattgtagtcttagctcatatgaaaatgggtattaaggcatgctatttttca |
39179411 |
T |
|
| Q |
290 |
tatttacccgttgcttaaaacctttttgaacaacataa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39179412 |
tatttacccgttgcttaaaacctttttgaacaagataa |
39179449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 58 - 133
Target Start/End: Original strand, 39179180 - 39179255
Alignment:
| Q |
58 |
tgtttttaaacgttaataacttagtttgtatacactgttagtctaaaataattttatacatgcattaagtcacttg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39179180 |
tgtttttaaacgttaataacttagtttgtatacactgttagtctaaaataattttatacatgcattaagtcacttg |
39179255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University