View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11835_high_112 (Length: 240)

Name: NF11835_high_112
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11835_high_112
NF11835_high_112
[»] chr7 (2 HSPs)
chr7 (81-186)||(2768132-2768239)
chr7 (81-159)||(2785698-2785776)
[»] chr2 (5 HSPs)
chr2 (79-156)||(41043399-41043477)
chr2 (81-159)||(38927019-38927096)
chr2 (104-208)||(1742271-1742372)
chr2 (93-168)||(41040012-41040083)
chr2 (180-224)||(41039971-41040014)
[»] chr1 (1 HSPs)
chr1 (109-158)||(28861437-28861485)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 81 - 186
Target Start/End: Complemental strand, 2768239 - 2768132
Alignment:
81 ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaa--agatgttagtactt 178  Q
    |||||||| ||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||| |||    
2768239 ttcactctctcttccctctcctcgtgattttggagatgtgttgttgcctcttggttggaagcttcttcttagtttgaagataaaagagatgttagtgctt 2768140  T
179 ggatctat 186  Q
    ||||||||    
2768139 ggatctat 2768132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 81 - 159
Target Start/End: Complemental strand, 2785776 - 2785698
Alignment:
81 ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaag 159  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||    
2785776 ttcactctgtcttccctctcatcctgattttggagatgtgttgttgcctcttggttggaagcttcttctaagtttgaag 2785698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 79 - 156
Target Start/End: Complemental strand, 41043477 - 41043399
Alignment:
79 ccttcactctgtcttccctctcatcctgattttggagatgtgtt-gtggcctcttggttggaagcttcttcttagtttg 156  Q
    ||||||| || |||||| |||| ||||||||||||||||||||| || ||||||||||| |||||||||||||||||||    
41043477 ccttcacactatcttccgtctcctcctgattttggagatgtgtttgttgcctcttggttagaagcttcttcttagtttg 41043399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 81 - 159
Target Start/End: Original strand, 38927019 - 38927096
Alignment:
81 ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaag 159  Q
    |||||| | ||||||||||| |||||||||||||||||| |||| ||||||| ||||||||| |||||||| |||||||    
38927019 ttcactttctcttccctctcctcctgattttggagatgttttgttgcctctt-gttggaagcctcttcttaatttgaag 38927096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 208
Target Start/End: Complemental strand, 1742372 - 1742271
Alignment:
104 ctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaaagatgttagtacttggatctattctcatagatatataag 203  Q
    |||||||||| |||||||||   ||| | || |||||||||||||||||||||||||  ||||||| | || ||||||| ||||  |  |||||||||||    
1742372 ctgattttggtgatgtgttg---cctttgggatggaagcttcttcttagtttgaagaggaaagatggtcgtgcttggatttattgccgcagatatataag 1742276  T
204 gtttt 208  Q
    |||||    
1742275 gtttt 1742271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 93 - 168
Target Start/End: Complemental strand, 41040083 - 41040012
Alignment:
93 tccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaaagat 168  Q
    |||||||| | ||||||||||||||    ||| |||||||||||||| | |||||||||||||||||| |||||||    
41040083 tccctctcctgctgattttggagat----tgttgcctcttggttggatgtttcttcttagtttgaagagaaaagat 41040012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 41040014 - 41039971
Alignment:
180 gatctattctcatagatatataaggttttaattaatccatttttg 224  Q
    |||||||| |||||||||||||||| | |||||||||||||||||    
41040014 gatctattgtcatagatatataagg-tctaattaatccatttttg 41039971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 158
Target Start/End: Original strand, 28861437 - 28861485
Alignment:
109 tttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaa 158  Q
    ||||||||| ||| || ||||||||||||||||||||| |||||||||||    
28861437 tttggagatttgt-gttgcctcttggttggaagcttctccttagtttgaa 28861485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University