View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_117 (Length: 239)
Name: NF11835_high_117
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_117 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 6177482 - 6177261
Alignment:
| Q |
1 |
cagtttcaacagcaactaacccgaggtttacatatatatgcaattagctataaccaaagaacgcctagcgaactcatttggtcatcatagtcaaaaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
6177482 |
cagtttcaacagcaactaacccgaggtttacatatatatgcaattagctataacaaaagaacgcctagcgaacgcatttggtcatcatagtcgaaaatat |
6177383 |
T |
 |
| Q |
101 |
agacaataatccttcaagtgttggtaattctctggatcataaaatctccaatagtaatcaatattaatctatccagcactggcgcttcaaattgaagaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6177382 |
agacaataatccttcaagtgttggtaattctctggatcataaaatctccaatagtaatcaatattaatctatctagcactggcgcttcaaattgaagaca |
6177283 |
T |
 |
| Q |
201 |
tgtctggtgtccgacaagtgtc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6177282 |
tgtctggtgtccgacaagtgtc |
6177261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University