View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_118 (Length: 238)
Name: NF11835_high_118
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_118 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 37928947 - 37929144
Alignment:
| Q |
20 |
tgattagagtttatttcatgcagcgaagatttatatttaagaaatatgatattaagatatctctatttacgagcaagaatttagatgagtacacaaatat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37928947 |
tgattagagtttatttcatgcagcgaagatttatatttaagaaatatgatattaagatatctctacttacgagcaagaatttagatgagtacacaaatat |
37929046 |
T |
 |
| Q |
120 |
tattacctctgcctcaatatctattaatgtacgtatacttaaaatatcaatttattttattcgtgcgtacctgttaaactattctctcttatccaatct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37929047 |
tattacctctgcctcaatatctattaatgtacgtatactt-aaatatcaatttattttattcgtgcgtacctgttaaactattctctcttatccaatct |
37929144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University