View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_132 (Length: 211)
Name: NF11835_high_132
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_132 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 14945163 - 14945349
Alignment:
| Q |
9 |
agaagcaaaggaatttagggagacggtcgaggagatggtgaaattaacaggggtttcaaacaaggcagattacttgccatttttaaggtggtttgatttt |
108 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14945163 |
agaagcgaaggaatttagggagacggttgaggagatggtgaaattaacaggggtttcaaacaaggcagattacttgccctttttaaggtggtttgatttt |
14945262 |
T |
 |
| Q |
109 |
cagaatttagagaagaggttacaaaatataagcaatagatttgatgctatcttgaatgcactcatttatgagaaccgtagtaagatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14945263 |
cagaatttagagaagaggttacaaaatataagcaatagatttgatgctatcttgaatgcactcatttatgagaaccgtagtaagatg |
14945349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University