View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_63 (Length: 366)
Name: NF11835_high_63
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 16 - 357
Target Start/End: Original strand, 36806070 - 36806414
Alignment:
| Q |
16 |
actctctcaacttcctatcaatctcaacaatttttctctcaaattcaccatgatcgggttcgttttccttctcttttaggttttaatcacttcatttgtt |
115 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
36806070 |
actctctcaacttccgatcaatctcaacaatttttctctcaaattcaccatgatcgggttcgttttccttctcttttagggtttaatcacttcatttttt |
36806169 |
T |
 |
| Q |
116 |
aatttaatcgcctatttagtaatttaattacttatttgnnnnnnnnnnnnnnnnnnn---tataacagtactactgaagaagatttgatagttgatccgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806170 |
aatttaatcgcctatttagtaatttaattacttatttgtgatgatgatgatgatgatgattataacagtactactgaagaagatttgatagttgatccgg |
36806269 |
T |
 |
| Q |
213 |
tggatacgcctgagattctggatgactttgaacttcctcaagaggaagctattgatatcaaagatatgcaagttaacaagctcaagttgtccagacgcat |
312 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806270 |
tggatacgcctgagattctggatgattttgaacttcctcaagaggaagctattgatatcaaagatatgcaagttaacaagctcaagttgtccagacgcat |
36806369 |
T |
 |
| Q |
313 |
taataacttcaaggttactactagtattaatttcattatctctgc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806370 |
taataacttcaaggttactactagtattaatttcattatctctgc |
36806414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University