View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_74 (Length: 326)
Name: NF11835_high_74
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 120 - 295
Target Start/End: Complemental strand, 44855738 - 44855563
Alignment:
| Q |
120 |
attattgcatctctannnnnnnacttatgtgtgttacttattaagttttcattgttttaaactttgtgaccgttgggaatttgatgtatcttgttaatat |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44855738 |
attattgcatctctatttttttacttatgtgtgttacttattaagttttcattgttttaaactttgtgaccgttgggaatttgatgtatcttgttaatat |
44855639 |
T |
|
| Q |
220 |
tattatgatcaaattgcatttgcaaattgtaattgttcaagttatgagcttctacgatataagtcatttacgcttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44855638 |
tattatgatcaaattgcatttgcaaattgtaattgttcaagttatgagcttctacgatataagtcatttacgcttc |
44855563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 44855793 - 44855752
Alignment:
| Q |
13 |
cagagatcattatgaaactatgaaaagagaa-aggtaaaaac |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44855793 |
cagagatcattatgaaactatgaaaagagaagaggtaaaaac |
44855752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University