View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_77 (Length: 314)
Name: NF11835_high_77
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 156 - 299
Target Start/End: Complemental strand, 20770449 - 20770306
Alignment:
| Q |
156 |
caaacagatcaatccattgcacgaaccaacaatcccacagcagtaacgggcatggaatcggctgtaatgatttccagtatgtgtgatgggcttcgacgta |
255 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20770449 |
caaatagatcaatccattgcacgaaccaacaatcccacaacagtaacgggcatggaatcggctgtaatgatttccagtacgtgtgatgggcttcgacgta |
20770350 |
T |
|
| Q |
256 |
ctccccagcaaaagactcacagagatgggtgcaacggtatatgt |
299 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20770349 |
ctctccagcaaaagactcacagagatgggtgcaacggtatatgt |
20770306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 20770526 - 20770444
Alignment:
| Q |
1 |
aatcaagggagatgatcacaaatttcttgattataagattattctgaggacaattataacgatgacagaccaaccaacaaata |
83 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20770526 |
aatcaagggagatgatcacaaattgcttgattataagattattctgaggacaattataacgatgacagaccaaccaacaaata |
20770444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 188
Target Start/End: Complemental strand, 29873938 - 29873906
Alignment:
| Q |
156 |
caaacagatcaatccattgcacgaaccaacaat |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
29873938 |
caaacagatcaatccattgcaggaaccaacaat |
29873906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University