View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_81 (Length: 298)
Name: NF11835_high_81
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 1530744 - 1530953
Alignment:
| Q |
18 |
caattctttcgtgagaggttcgggatcgtttagttcgctgtgaaatagcagtgttgtttcttcaaattcaaatttttgggtcaaagtttggagttttaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1530744 |
caattctttcgtgagaggttcgggatcgtttagttcgctgtgaa-tagcagtgttgtttcttcaaattcaaatttttgggtcaaagtttggagttttagg |
1530842 |
T |
|
| Q |
118 |
ttgcaaagggaaatgcagcctctgcttgaagttactcccattacttgatcttatatatgctatggactcaatcctggtgctattcgggtccttaatatat |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1530843 |
ttgaaaagggaaatgcagcctctgcttgaagttactcccattacttgatcttatatatgctatggactcaatcctggtgctattcgggtccttaatatat |
1530942 |
T |
|
| Q |
218 |
tatcaatactg |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
1530943 |
tatcaatactg |
1530953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 164 - 259
Target Start/End: Original strand, 10142725 - 10142815
Alignment:
| Q |
164 |
gatcttatatatgctatggactcaatcctggtgctattcgggtccttaatatattatcaatactgcattcagatatttgcttcgaggtcatactca |
259 |
Q |
| |
|
|||||||||| |||||||||||||| | || |||||||| || |||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10142725 |
gatcttatatttgctatggactcaaactcggggctattcgcgttcttaatat-----caatactgcattgagatatttgcttcgaggtcatactca |
10142815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 113 - 162
Target Start/End: Original strand, 10142623 - 10142672
Alignment:
| Q |
113 |
ttaagttgcaaagggaaatgcagcctctgcttgaagttactcccattact |
162 |
Q |
| |
|
||||||||| | ||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
10142623 |
ttaagttgccaggggaaatgcagccacagcttgaagttactccaattact |
10142672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University