View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_83 (Length: 292)
Name: NF11835_high_83
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 273
Target Start/End: Original strand, 34076499 - 34076751
Alignment:
| Q |
15 |
aaaaacaacaatcgacacacggtttatgcacgtattaatattaaacaaggttgtcagtttgctacaacttttttggtcaagttgtggatgacagnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34076499 |
aaaaacaacaatcgacacacggtttatgcacgtattaa------acaaggttgtcagtttgctacaactttttcggtcaagttgtggatgacagaaaaaa |
34076592 |
T |
|
| Q |
115 |
nntataccagataaaatgcatcttcaaaaataagggtgagctaggaattgttgaatgccaaccctgccttgttttattggtgttggtggatagtgctttg |
214 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076593 |
aatataccagatgaaatgtatcttcaaaaataagggtgagctaggaattgttgaatgccaaccctgccttgttttattggtgttggtggatagtgctttg |
34076692 |
T |
|
| Q |
215 |
tcaccattccatacccttaataaagctcaaaattgtggtaacaaacaaccccacaatat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076693 |
tcaccattccatacccttaataaagctcaaaattgtggtaacaaacaaccccacaatat |
34076751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 166
Target Start/End: Complemental strand, 29071714 - 29071676
Alignment:
| Q |
128 |
aaatgcatcttcaaaaataagggtgagctaggaattgtt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29071714 |
aaatgcatcttcaaaaataagggtgagctaggaattgtt |
29071676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 29071794 - 29071754
Alignment:
| Q |
68 |
tcagtttgctacaacttttttggtcaagttgtggatgacag |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29071794 |
tcagtttgctacaacctttttggtcaagttgtggatgacag |
29071754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University