View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_84 (Length: 288)
Name: NF11835_high_84
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_84 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 288
Target Start/End: Original strand, 31601432 - 31601727
Alignment:
| Q |
7 |
actttcaccctttttaaaacatattgtctagaatttgaccttgcccttcatctatactatcccaaaatgatggactctcccaacaagaac---------- |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31601432 |
actttcaccctttttaaaacatattgtctagaatttgaccttgcccttcatctatactatcccaaaatgatggactctcccaacaagaactaaaagcaag |
31601531 |
T |
 |
| Q |
97 |
------caatatgcattcttatgtgaattagttgcaatggttattaaaattcacatatttagctatacttttagaaagtagataacttggaagagagttt |
190 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31601532 |
tataaccaatatccattcttatgtgaattagttgcaatggttattaaaattcacatatttagctatacttttagaaagtagataacttggaagagagttt |
31601631 |
T |
 |
| Q |
191 |
ttagtatgtaattagaaatgaaaattaacttagcaccactcaaaagtgtatggtgtcaaactcaaggttggaaagagattcatcttaagggacaaacc |
288 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31601632 |
ttagtatgtgactagaaatgaaaattaacctagcaccactcaaaagag--tggtgtcaaactcaaggttggaaagagattcatcttaaaggacaaacc |
31601727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University