View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_high_99 (Length: 256)
Name: NF11835_high_99
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_high_99 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 25 - 256
Target Start/End: Complemental strand, 34077392 - 34077161
Alignment:
| Q |
25 |
gtacttttgtgcttcaattaatgtgaaagtggcctatgctttgtattattcttggttttggcccattcacactttcactttggtttgtgatttgctttgc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077392 |
gtacttttgtgcttcaattaatgtgaaagtggcctatgctttgtattattcttggttttggcccattcacactttcactttggtttgtgatttgctttgc |
34077293 |
T |
 |
| Q |
125 |
tttgctccatgaatggcaaagctaaagctgtacgtttgtctattccttaccgtactaagcatttttggaatctagaaagcatgatgccacccctatctaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077292 |
tttgctccatgaatggcaaagctaaagctgtacgtttgtccattccttaccgtactaagcatttttggaatctagaaagcatgatgccacccctatctaa |
34077193 |
T |
 |
| Q |
225 |
ggtgttctttatttttatgaccactatcggtt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34077192 |
ggtgttctttatttttatgaccactatcggtt |
34077161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 120 - 164
Target Start/End: Original strand, 10483138 - 10483182
Alignment:
| Q |
120 |
tttgctttgctccatgaatggcaaagctaaagctgtacgtttgtc |
164 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
10483138 |
tttgctttgctctatgaatggcaaagctaaagctgtatgtttgtc |
10483182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University