View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_104 (Length: 250)
Name: NF11835_low_104
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_104 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 14269 - 14050
Alignment:
| Q |
1 |
gttggcaactatgttaataagtgacatatattcgttgataagtaaacagacgctcgaatgtagcgcagcagagcgagtggatctgaaagcgtaacgagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14269 |
gttggcaactatgttaataagtgacatatattcgttgataagtaaacagacgctcgaatgtagcgcagcagagcgagtggatctgaaagcgtaacgagtg |
14170 |
T |
 |
| Q |
101 |
aagcagacgaagtgcaaattgttgtaatctagaaattagtctgttaatcaatgccttttgacagcacattgtcaaaatctagaactctaaatatcaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14169 |
aagcagacgaagtgcaaattgttgtaat------------------atcaatgccttttgacagcacattgtcaaaatctagaactctaaatatcaaaat |
14088 |
T |
 |
| Q |
201 |
catcaaacttgtaaacttttctttaaatatgttcatct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14087 |
catcaaacttgtaaacttttctttaaatatgttcatct |
14050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University