View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_113 (Length: 240)
Name: NF11835_low_113
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_113 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 81 - 186
Target Start/End: Complemental strand, 2768239 - 2768132
Alignment:
| Q |
81 |
ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaa--agatgttagtactt |
178 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
2768239 |
ttcactctctcttccctctcctcgtgattttggagatgtgttgttgcctcttggttggaagcttcttcttagtttgaagataaaagagatgttagtgctt |
2768140 |
T |
 |
| Q |
179 |
ggatctat |
186 |
Q |
| |
|
|||||||| |
|
|
| T |
2768139 |
ggatctat |
2768132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 81 - 159
Target Start/End: Complemental strand, 2785776 - 2785698
Alignment:
| Q |
81 |
ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaag |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
2785776 |
ttcactctgtcttccctctcatcctgattttggagatgtgttgttgcctcttggttggaagcttcttctaagtttgaag |
2785698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 79 - 156
Target Start/End: Complemental strand, 41043477 - 41043399
Alignment:
| Q |
79 |
ccttcactctgtcttccctctcatcctgattttggagatgtgtt-gtggcctcttggttggaagcttcttcttagtttg |
156 |
Q |
| |
|
||||||| || |||||| |||| ||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
41043477 |
ccttcacactatcttccgtctcctcctgattttggagatgtgtttgttgcctcttggttagaagcttcttcttagtttg |
41043399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 81 - 159
Target Start/End: Original strand, 38927019 - 38927096
Alignment:
| Q |
81 |
ttcactctgtcttccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaag |
159 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||| |||| ||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
38927019 |
ttcactttctcttccctctcctcctgattttggagatgttttgttgcctctt-gttggaagcctcttcttaatttgaag |
38927096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 104 - 208
Target Start/End: Complemental strand, 1742372 - 1742271
Alignment:
| Q |
104 |
ctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaaagatgttagtacttggatctattctcatagatatataag |
203 |
Q |
| |
|
|||||||||| ||||||||| ||| | || ||||||||||||||||||||||||| ||||||| | || ||||||| |||| | ||||||||||| |
|
|
| T |
1742372 |
ctgattttggtgatgtgttg---cctttgggatggaagcttcttcttagtttgaagaggaaagatggtcgtgcttggatttattgccgcagatatataag |
1742276 |
T |
 |
| Q |
204 |
gtttt |
208 |
Q |
| |
|
||||| |
|
|
| T |
1742275 |
gtttt |
1742271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 93 - 168
Target Start/End: Complemental strand, 41040083 - 41040012
Alignment:
| Q |
93 |
tccctctcatcctgattttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaagataaaagat |
168 |
Q |
| |
|
|||||||| | |||||||||||||| ||| |||||||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
41040083 |
tccctctcctgctgattttggagat----tgttgcctcttggttggatgtttcttcttagtttgaagagaaaagat |
41040012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 41040014 - 41039971
Alignment:
| Q |
180 |
gatctattctcatagatatataaggttttaattaatccatttttg |
224 |
Q |
| |
|
|||||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
41040014 |
gatctattgtcatagatatataagg-tctaattaatccatttttg |
41039971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 109 - 158
Target Start/End: Original strand, 28861437 - 28861485
Alignment:
| Q |
109 |
tttggagatgtgttgtggcctcttggttggaagcttcttcttagtttgaa |
158 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
28861437 |
tttggagatttgt-gttgcctcttggttggaagcttctccttagtttgaa |
28861485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University