View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_125 (Length: 228)
Name: NF11835_low_125
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_125 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 85 - 225
Target Start/End: Original strand, 43176884 - 43177029
Alignment:
| Q |
85 |
gggtatgcattagcaactacttaaggaagtctcaacattaatggttgt-----agccgagatcattctacggatttcaaagatatactccgtacctgtcc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43176884 |
gggtatgcattagcaactacttaaggaagtctgaacattaatggttgtattgtagccgagatcattctacggatttcaaagatatactccgtacctgtcc |
43176983 |
T |
 |
| Q |
180 |
tttttgttcagtgaagaccgattcaattgagaatctcaatcattga |
225 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43176984 |
tttttcttcagtgaagaccgattcaattgagaatctcaatcattga |
43177029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 43176800 - 43176846
Alignment:
| Q |
18 |
aataatatatctttggtgagtgcaatgaaatctctctctcaacttagtt |
66 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
43176800 |
aataatatatctttggtgagtgcaatgcaatctc--tctcaacttagtt |
43176846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 43176787 - 43176837
Alignment:
| Q |
8 |
attgatgatc---aataatatatctttggtgagtgcaatgaaatctctctc |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43176787 |
attgatgatcaataataatatatctttggtgagtgcaatgcaatctctctc |
43176837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 108
Target Start/End: Complemental strand, 43219647 - 43219604
Alignment:
| Q |
65 |
ttctggaataaagaattgaagggtatgcattagcaactacttaa |
108 |
Q |
| |
|
||||||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
43219647 |
ttctggaataatgaattgaaggctatgcatcagcaactacttaa |
43219604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University