View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_132 (Length: 211)
Name: NF11835_low_132
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_132 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 26 - 197
Target Start/End: Complemental strand, 6365131 - 6364960
Alignment:
| Q |
26 |
atgtagtaggtataaagaacatttgagctgtaaaaaacatcaaattttggaatagctataacgtgttactactatttaaaatcatcatcagtgaaattga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365131 |
atgtagtaggtataaagaacatttgagctgtaaaaaacatcaaattttggaatagctataacgtgttactactatttaaaatcatcatcagtgaaattga |
6365032 |
T |
 |
| Q |
126 |
gagtccaatttttgtataggaaaaaccggtaaaggcaaagtcggagagaaaacgtatctgaaaagtgttatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
6365031 |
gagtccaatttttgtataggaaaaaccggaaaaggcaaagtgggagagaaaacgtatctggcaagtgttatt |
6364960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 6365169 - 6365141
Alignment:
| Q |
1 |
atttgatataattaagggcaagtggatgt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6365169 |
atttgatataattaagggcaagtggatgt |
6365141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University