View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_136 (Length: 206)
Name: NF11835_low_136
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_136 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 7 - 188
Target Start/End: Original strand, 26009121 - 26009302
Alignment:
| Q |
7 |
agaagcaaagggaagcataaaaaacaatttacaaaacaataaaatattttattgctctcaacttgcaattaattacaaggataaaattgcaaatcctctc |
106 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26009121 |
agaagcaaaaggaaacataaaaaacaatttacaaaacaataaaatattgtattgctctcaacttgcaattaattacaaggataaaattgcaaatcctctc |
26009220 |
T |
 |
| Q |
107 |
aattataatttttgcatgtgaacattaaaaattgcaaacttactcaaagacattgaaatacccaatcaatgtacacccctat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26009221 |
aattataatttttgcatgtgaacattaaaaattgcaaacttactcaaagacattgaaatacccaatcaatgtacacccctat |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University