View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_137 (Length: 201)
Name: NF11835_low_137
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_137 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 48801143 - 48800956
Alignment:
| Q |
1 |
tccagatgtctagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaac--tagttcg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
48801143 |
tccagatgtctagtctctggcttgaggaatgtgttgagagtccttcaagccggttttttgaatattttgagtccggtccaatttttaaaacattagttgg |
48801044 |
T |
 |
| Q |
99 |
cctatttctctttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48801043 |
cctatttctctttctaacttttgggtattcaaaccaagtgtattagacaaaaatatctcatgctttatttgattgtctgcttcttctc |
48800956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University