View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_49 (Length: 392)
Name: NF11835_low_49
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 42264485 - 42264609
Alignment:
| Q |
1 |
ccacctattgaaaaatcgcgctgattttctcttgaggaagagttttgccatccattgttagtctttgcagttgcgtgcacaagatacctattaacatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42264485 |
ccacctattgaaaaatcgcgctgattttctcttgaggaagagttttgccatccattgttagtctttgcagttgcgtgcacaagatacctattaacatagc |
42264584 |
T |
 |
| Q |
101 |
gccttccctctttgttctatatatg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42264585 |
gccttccctctttgttctatatatg |
42264609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 42264628 - 42264730
Alignment:
| Q |
151 |
ttgacatattcattccagaatcaaaattattaaggctaggatttcgtccgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagtct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42264628 |
ttgacatattcattccagaatcaaaattattaaggctaggatttcgtctgtttcttcattctctttgtttgctttgcaactcaggtgtgctagagagttt |
42264727 |
T |
 |
| Q |
251 |
gtg |
253 |
Q |
| |
|
||| |
|
|
| T |
42264728 |
gtg |
42264730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 343 - 385
Target Start/End: Original strand, 42264819 - 42264861
Alignment:
| Q |
343 |
cttgtgtagccctgttaaacgtgacttttgcttgtctctgctt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42264819 |
cttgtgtagccctgttaaacgtgacttttgcttgtctctgctt |
42264861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University