View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_50 (Length: 388)
Name: NF11835_low_50
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 21 - 384
Target Start/End: Complemental strand, 34382471 - 34382108
Alignment:
| Q |
21 |
gctagaaggagtggtatcaaaaaatgaaacaggtgccctaaaaaccgatgtgatcattccatgaaaaaggcgctgagctgtttccacggaaactgttgcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382471 |
gctagaaggagtggtatcaaaaaatgaaacaggtgccctaaaaaccgatgcgatcattccatgaaaaaggcgctgagctgtttccacggaaactgttgcc |
34382372 |
T |
 |
| Q |
121 |
attaaaacagtccttaccaatatgaagatggagcttccaccagataaaagagcaaaaactcccataagctgcacattgtcgacccttcccnnnnnnnctg |
220 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34382371 |
attaaaactgtccttcccaatatgaagatggagcttccaccagataaaagagcgaaaactcccataagctgcacattgtcgacccttccctttttttctg |
34382272 |
T |
 |
| Q |
221 |
tagcccaagacatccaataattgcttcccatttgcataacttgaaatagaatttggcagagaagaataattggaaccagtgctcctctataagctaatgt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34382271 |
tagcccaagacatccaataattgcttcccatttgcataacttgaaatagaatttggcagagaagaataattggaaccagtgctcctctataagctaatgt |
34382172 |
T |
 |
| Q |
321 |
gacaaaggttgaataaacactccattttactcgaccagtcattgcttcctcttctctgcttctc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34382171 |
gacaaaggttgaataaacactccattttactcgaccagtcattgcttcctcttctctggttctc |
34382108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University