View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_65 (Length: 358)
Name: NF11835_low_65
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 38932888 - 38932819
Alignment:
| Q |
1 |
catttgtgacttgtgagattatttggttaaaacattaattaatgatgatcaagcaaacacgcattctgca |
70 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38932888 |
cattagtgacttgtgagattatttggttaaaacattaattaatgatgatcaagcaaacatgcattctgca |
38932819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 189 - 340
Target Start/End: Original strand, 55827367 - 55827523
Alignment:
| Q |
189 |
aattgctattgtttttgcgcttcacttgatgcataagatatgatataattatagctaaccaatctacgaagataagga--------tgatgatacaaggg |
280 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||| ||||||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
55827367 |
aattgctattgcttttgc--ttcttttgatgcataagatatacagtaattatagctaaccaatctacgaaaataaggaaggattgtggacgatacaaggg |
55827464 |
T |
|
| Q |
281 |
aagaagaggggttttaaannnnnnnagggattgtactatcgaaattaaggagatactttc |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
55827465 |
aagaagaggggttttaaa-aaatttagggattgtgccatcgaaattaaggagatactttc |
55827523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University