View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11835_low_80 (Length: 303)
Name: NF11835_low_80
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11835_low_80 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 4689037 - 4689226
Alignment:
| Q |
18 |
aactcttgcttttatacatttattttttagggatcttgcttttatacatttaataattgaagagtagcacttgtatggccacatgcataaataatttgga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4689037 |
aactcttgcttttatacatttattttttagggatcttgcttttgtacatttaataattgaagagtaacacttgtatggtcacatgcataaataatttgga |
4689136 |
T |
|
| Q |
118 |
tttagacacacacaattgataaaaagtacaggagcaaataaaacttgtgaccatataagttttgctcacac--tatatatgtataagtta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
4689137 |
tttagacacacacaattgataaaaagtacaggagcaaataaaacttgtgaccatataagtttttctcacactatatatatgtataagtta |
4689226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University