View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11835_low_80 (Length: 303)

Name: NF11835_low_80
Description: NF11835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11835_low_80
NF11835_low_80
[»] chr2 (1 HSPs)
chr2 (18-205)||(4689037-4689226)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 4689037 - 4689226
Alignment:
18 aactcttgcttttatacatttattttttagggatcttgcttttatacatttaataattgaagagtagcacttgtatggccacatgcataaataatttgga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||    
4689037 aactcttgcttttatacatttattttttagggatcttgcttttgtacatttaataattgaagagtaacacttgtatggtcacatgcataaataatttgga 4689136  T
118 tttagacacacacaattgataaaaagtacaggagcaaataaaacttgtgaccatataagttttgctcacac--tatatatgtataagtta 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  |||||||||||||||||    
4689137 tttagacacacacaattgataaaaagtacaggagcaaataaaacttgtgaccatataagtttttctcacactatatatatgtataagtta 4689226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University