View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11836_high_31 (Length: 298)
Name: NF11836_high_31
Description: NF11836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11836_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 285
Target Start/End: Original strand, 33252938 - 33253201
Alignment:
| Q |
19 |
aacaagtatatataatccatcctttatgtacatctatcaagccttatgactggtctacatgaccaatagagccgcattatgtgtgtgaataattttagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252938 |
aacaagtatatataatccatcctttatgtacatctatcaagccttatgactggtctacatga---atagagccgcattatgtgtgtgaataattttagag |
33253034 |
T |
 |
| Q |
119 |
tttgatgatatgctgagtacggttcttgatgtttactagttcctatgaacatgtgtagcagtccccactatccactcttttggataaaaatatcattgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33253035 |
tttgatgatatgctgagtacggttattgatgtttaccggttcctatgaacatgtgtagcagtccccactatccactcttttggataaaaatatcatcgtc |
33253134 |
T |
 |
| Q |
219 |
tgccctattttttcttgttacttgctagtcgtgtttttaaccaattttctagggtgtgagggtatct |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33253135 |
tgccctattttttcttgttacttgctagtcgtgtttttaaccaattttctagggtgtgagggtatct |
33253201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University