View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11836_high_33 (Length: 291)
Name: NF11836_high_33
Description: NF11836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11836_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 63 - 283
Target Start/End: Original strand, 35244319 - 35244539
Alignment:
| Q |
63 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35244319 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
35244418 |
T |
|
| Q |
163 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35244419 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
35244518 |
T |
|
| Q |
263 |
caaggtatttatgttcatctc |
283 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35244519 |
caaggtatttatgttcatctc |
35244539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 141
Target Start/End: Original strand, 35242275 - 35242350
Alignment:
| Q |
65 |
tgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtct |
141 |
Q |
| |
|
|||| |||||||||| ||| ||||||||| | ||||||| ||||||| ||||||| ||| ||| |||||||||||| |
|
|
| T |
35242275 |
tgataataatgtatggacacaaatacatgagagtataaaattaataag-ttttcaggcataactcggtaggttgtct |
35242350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University