View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11836_high_41 (Length: 249)
Name: NF11836_high_41
Description: NF11836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11836_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 10509397 - 10509599
Alignment:
| Q |
1 |
agatgtttcgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttt-tgatagaaaacaatagaaatgaa |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10509397 |
agatgtttcgaatctgcttcattggctcagacatggttgctgctgctgcgtttcttcaacttctagggtttgttttttgatagaaaacaatagaaatgaa |
10509496 |
T |
|
| Q |
100 |
atggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatcatcgtcatcgtcatcttcgtactacactttgatgaatca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10509497 |
atggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatcatcgtcatcgtcatcttcgtactacactttgatgaatca |
10509596 |
T |
|
| Q |
200 |
ttt |
202 |
Q |
| |
|
||| |
|
|
| T |
10509597 |
ttt |
10509599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 132
Target Start/End: Original strand, 10495200 - 10495313
Alignment:
| Q |
9 |
cgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttttgatagaaaacaatagaaatgaaatggaaatt |
108 |
Q |
| |
|
|||||| ||| |||||| |||||||| || |||||||||||||||| ||||||| |||||| ||||||||||||||||| |||||||||| | |
|
|
| T |
10495200 |
cgaatctgctccattggttcagacatggttgctgctgctgcgtttc---aacttct----tttgtt---gatagaaaacaatagaa-tgaaatggaattg |
10495288 |
T |
|
| Q |
109 |
-gtgctatgtaaaaccctttgggta |
132 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10495289 |
cgtgctatgtaaaaccctttgggta |
10495313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 188
Target Start/End: Complemental strand, 7462319 - 7462281
Alignment:
| Q |
150 |
catgtgatatcatcgtcatcgtcatcttcgtactacact |
188 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7462319 |
catgtgatatcatcctcatcgtcatcttcgtactgcact |
7462281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University