View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11836_low_35 (Length: 273)
Name: NF11836_low_35
Description: NF11836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11836_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 54470009 - 54470275
Alignment:
| Q |
1 |
aaagactaaattgtctcttttcaattatcgttagagaccataatttttccttaattcagtcacataactgtatatgcaatatagtgacttagtggattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54470009 |
aaagactaaattgtctcttttcaattatcgttagagaccataatttttccttaattcagtcacataactgtatatgcaatatagtgacttagtggattga |
54470108 |
T |
|
| Q |
101 |
cacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaaccaaagtgcttcagttatggagtcctccctcgaggggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54470109 |
cacggaagatgaatatattacatgttagaaaaacaaaattgatggaggttatatttaagaactaaagtgcttcagttgtggagtcctccctcgaggggct |
54470208 |
T |
|
| Q |
201 |
tcttaaaaatcaacgtagattctcatcttctagatgatggcatgttggggtttaggattcatctctc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54470209 |
tcttaaaaatcaacgtagattctcatcttctagatgatggcatgttggggtttaggattcatctctc |
54470275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University