View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11836_low_42 (Length: 249)

Name: NF11836_low_42
Description: NF11836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11836_low_42
NF11836_low_42
[»] chr2 (3 HSPs)
chr2 (1-202)||(10509397-10509599)
chr2 (9-132)||(10495200-10495313)
chr2 (150-188)||(7462281-7462319)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 10509397 - 10509599
Alignment:
1 agatgtttcgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttt-tgatagaaaacaatagaaatgaa 99  Q
    |||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
10509397 agatgtttcgaatctgcttcattggctcagacatggttgctgctgctgcgtttcttcaacttctagggtttgttttttgatagaaaacaatagaaatgaa 10509496  T
100 atggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatcatcgtcatcgtcatcttcgtactacactttgatgaatca 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10509497 atggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatcatcgtcatcgtcatcttcgtactacactttgatgaatca 10509596  T
200 ttt 202  Q
    |||    
10509597 ttt 10509599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 132
Target Start/End: Original strand, 10495200 - 10495313
Alignment:
9 cgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttttgatagaaaacaatagaaatgaaatggaaatt 108  Q
    |||||| ||| |||||| |||||||| || ||||||||||||||||   |||||||    ||||||   ||||||||||||||||| |||||||||| |     
10495200 cgaatctgctccattggttcagacatggttgctgctgctgcgtttc---aacttct----tttgtt---gatagaaaacaatagaa-tgaaatggaattg 10495288  T
109 -gtgctatgtaaaaccctttgggta 132  Q
     ||||||||||||||||||||||||    
10495289 cgtgctatgtaaaaccctttgggta 10495313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 188
Target Start/End: Complemental strand, 7462319 - 7462281
Alignment:
150 catgtgatatcatcgtcatcgtcatcttcgtactacact 188  Q
    |||||||||||||| ||||||||||||||||||| ||||    
7462319 catgtgatatcatcctcatcgtcatcttcgtactgcact 7462281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University