View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_16 (Length: 395)
Name: NF11837_low_16
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 382
Target Start/End: Original strand, 882867 - 883233
Alignment:
| Q |
16 |
atacagagtttaatcttgatacactgttgtcgatgtnnnnnnnnntctatcaagtgattatgatcaaaatcaatcatttattttttgggttatggcaacg |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882867 |
atacagagtctaatcttgatacactgttgtcgatgtaaaaaaaaatctatcaagtgattatgatcaaaatcaatcatttattttttgggttatggcaacg |
882966 |
T |
 |
| Q |
116 |
accaccacctgaannnnnnnnnnnnnacttaggacccatcagatagcaatatcaagcttgaatgtctaatttctaagtttaattttgatacactattcgt |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882967 |
accaccacctgaaacacacacacacaacttaggacccatcagatagcaatatcaagcttgaatgtctaatttctaagtttaattttgatacactattcgt |
883066 |
T |
 |
| Q |
216 |
ataaaaatagtttaatctatcgagtggttatgatcaaaatctatcannnnnnnncagggtccgtagccgaagtaacaaccaccaccctgaaactcaaaca |
315 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
883067 |
ataaaaataatttaatctatcgagtggttatgatcaaaatctatcattttttttcagggtccgtagccgaagtaacaaccaccaccctgaaactcacaca |
883166 |
T |
 |
| Q |
316 |
cacaattgcaaggtcctagtaaaaatactgtcctagtaaaaatatttaaactatgaagtggttaatg |
382 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
883167 |
cacaattgcaaggtcctagtaaaaatattgtcctagtaaaaatatttaaactatgaagtggttaatg |
883233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University