View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_20 (Length: 298)
Name: NF11837_low_20
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 32667012 - 32666742
Alignment:
| Q |
18 |
tggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32667012 |
tggaattggtggtgattatcctttatcttctaccattatgtctgagtttgctaataaaaggacaagaggttcttttatagctgcggttttttctatgcaa |
32666913 |
T |
|
| Q |
118 |
gggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32666912 |
gggtttggtatattggctagtgcaactgttactatggtggtttgcttggtatttcgcagcggttcgaagccggcaacggcttttgatgtgccgccggagg |
32666813 |
T |
|
| Q |
218 |
ctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcctatg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32666812 |
ctgacgttgcatggaggttgatattgatgattggttcagttccagctgcattgacttattattggcgtatg |
32666742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 33109295 - 33109402
Alignment:
| Q |
18 |
tggaattggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaa |
117 |
Q |
| |
|
|||||||||||||||||| ||| | ||| |||| ||||||||||||| ||| || || | ||| |||| ||||||| ||||| || ||| |||||||| |
|
|
| T |
33109295 |
tggaattggtggtgattaccctctttctgctacaattatgtctgagtatgcgaacaagaagacgcgaggagcttttatcgctgcagtgtttgctatgcaa |
33109394 |
T |
|
| Q |
118 |
gggtttgg |
125 |
Q |
| |
|
|| ||||| |
|
|
| T |
33109395 |
ggatttgg |
33109402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 135
Target Start/End: Complemental strand, 37315878 - 37315765
Alignment:
| Q |
22 |
attggtggtgattatcctttatcttctaccattatgtctgagtttgcaaataaaaggacaagaggttcttttatagctgcggttttttctatgcaagggt |
121 |
Q |
| |
|
|||||||||||||| ||| | || |||| ||||||||||| | ||| || |||| ||| | || | ||||||||| |||||||| |||||||||||| |
|
|
| T |
37315878 |
attggtggtgattaccctctttcagctactattatgtctgaatatgccaacaaaaagactcgtggcgcgtttatagcttcggtttttgctatgcaagggt |
37315779 |
T |
|
| Q |
122 |
ttggtatattggct |
135 |
Q |
| |
|
|||| || |||||| |
|
|
| T |
37315778 |
ttggaattttggct |
37315765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University