View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_26 (Length: 263)
Name: NF11837_low_26
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 38 - 256
Target Start/End: Original strand, 11134633 - 11134851
Alignment:
| Q |
38 |
ctatcatgcttcaattgcagaaaggagaaatgtcaaagcacgaagctcttggaaacgaatggttggaaaatggtaactgcccaattgccaagtcttatag |
137 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11134633 |
ctatcatgcttcaattccaggaaggagaaatgtcaaagcacgaagcacttggaaacgaatggttggaaaatggtaactgcccaattgccaagtcttatag |
11134732 |
T |
 |
| Q |
138 |
agccgcaagccgtgttgtcccccttgttgcaacagctttgaagccaccaactgccatgaaatttaaatgcccagcagcagttgttgctgccagggccgcc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11134733 |
agccgcaagccgtgttgtcccccttgttgcaacagctttgaagccaccaactgccatgaaatttaaatgcccagcagcagttgttgctgccagggccgcc |
11134832 |
T |
 |
| Q |
238 |
cttgctcgtacagcctttg |
256 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11134833 |
cttgctcgtacagcctttg |
11134851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University