View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_27 (Length: 244)
Name: NF11837_low_27
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40303294 - 40303058
Alignment:
| Q |
1 |
tgattttttcctttgcccctatttttcatatgcttctttaggaaacttaataggttgtagaatgtgaatattggacaaacagtaatttgtattattgatg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
40303294 |
tgattttgtcctttgcccctatttttcatatgcttctttaggaaacttaataggttgtagaatgtgaacattggacaaacagtaatgtgtactattgatg |
40303195 |
T |
 |
| Q |
101 |
aaccaaacaaattacattggtagaagnnnnnnnngttctgatagcaacgagtctactagcccttttctctttgtcccactataacagacttcatcataac |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40303194 |
aaccaaacaaattacattggtagaagaaaaaaaagttctgatagtaacgagtctactagcccttt--tctttgtcccactataacagacttcatcataac |
40303097 |
T |
 |
| Q |
201 |
ctccaatttctcactctttataactaacttacgcttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40303096 |
ctccaatttctcactctttataactaacttacgcttcat |
40303058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University