View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_31 (Length: 232)
Name: NF11837_low_31
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 46844253 - 46844044
Alignment:
| Q |
1 |
ctcatagaagtggttatattcaatcacttctattctcttaagtcttaacatattatcaatatctacatgtcagcgttaatgttagtgccgtgtccagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46844253 |
ctcatagaagtggttatattcaatcacttctattctcttaagtcttgacatattatcaatatctacatgtcag------tgttagtgccgtgtccagttt |
46844160 |
T |
|
| Q |
101 |
tgcctcggtgcatgttatcatccctagggggtaaaagaataagcaattacctgtacatgtagatgtctttaccctgctcaagattcttcttgcagtgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844159 |
tgcctcggtgcatgttatcatccctagggggtaaaagaataagcaattacctgtacatgtagatgtctttaccctgctcaagattcttcttgcagtgaaa |
46844060 |
T |
|
| Q |
201 |
acatacactcagaaag |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46844059 |
acatacactcagaaag |
46844044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 216
Target Start/End: Complemental strand, 46848029 - 46847944
Alignment:
| Q |
128 |
ggggtaaaagaataagcaattacctgtacatgtagatgtctttaccctgctcaagattcttcttgcagtgaaaacatacactcagaaag |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||| ||||| |||| |||||||||| || ||||||| ||||| |||| |
|
|
| T |
46848029 |
ggggttaaagaataagcaattacctgtacatgtagatatcttttccctg---aagactcttcttgcattggaaacatatactcaaaaag |
46847944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University