View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11837_low_8 (Length: 610)
Name: NF11837_low_8
Description: NF11837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11837_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 336 - 597
Target Start/End: Complemental strand, 18741260 - 18740999
Alignment:
| Q |
336 |
aaacactaggataagtctatttttgaatattttgcatgccaaaaacgaaggctttcaacataattttcatgactatattgaattctctgtcaaaatttaa |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18741260 |
aaacactaggataagtctatttttgaatattttgcatgccaaaaacaaaggctttcaacatatttttcatgactatattgaattctctgtcaaaatttaa |
18741161 |
T |
|
| Q |
436 |
tacaactttgagagaaataggtgagagacagattgtctctttcaatataccccaccctccaaggtcttgggcaggtccctttcttctacgtaggatatta |
535 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18741160 |
tacaactttgagagaaataggtgagagacagattgtctctttcaatataccccaccctccaaggtcttgggcaggtccctttcttctatgtaggatatta |
18741061 |
T |
|
| Q |
536 |
aattcaaaactgtccaattcagtgctcctttgattgggataccaactcagaaactttactca |
597 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18741060 |
aattcaaaactgtccaattcagtggtcctttgtttgggataccaactcagaaactttactca |
18740999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 18741775 - 18741588
Alignment:
| Q |
20 |
tattaatttttgttttggaaattgtagaatataaggactttttaagaagtaaatttctaatattttggaggtctatga---------ccttgatcgactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18741775 |
tattaatttttgttttggaaattgtagaatataaggactttttaagaagtaaatttctaatattttggaggtctatgatgattgataccttgatcgactt |
18741676 |
T |
|
| Q |
111 |
gtttttggaccagccttgcttatttatatagattatttatatgtctttaatgcataatgaagtataataatttgagagttatctatctat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18741675 |
gtttttggaccagccttgcttatttatatagattatt--tatgtctttaatgcataatgaagtataataatttgagagttatctatctat |
18741588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University