View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11838_high_11 (Length: 320)
Name: NF11838_high_11
Description: NF11838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11838_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 2 - 300
Target Start/End: Original strand, 52987858 - 52988156
Alignment:
| Q |
2 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987858 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
52987957 |
T |
|
| Q |
102 |
gcataattgacgattcgatcgattcctttgaatagccctcattcttgcatcatggactaacttccctctcatttggaccctcacagccaccacacacaac |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987958 |
gcataattgacgattctatcgattcctttgaatagccctcattcttgcaacatggactaacttccctctcatttggaccctcacagccaccacacacaac |
52988057 |
T |
|
| Q |
202 |
aggcaatttggggcagtctgtacaagaatctttttctttctctgccggacttgaacaaccatgcatcgaggctaattcaacgtgctcggtgatgatgtc |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52988058 |
aggcaatttggggcagtctttacaagaatctttttctttctctgccagatttgaacaaccatgcatcgaggctaattcaacgtgctcggttatgatgtc |
52988156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University