View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11839_high_6 (Length: 286)
Name: NF11839_high_6
Description: NF11839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11839_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 46072152 - 46072388
Alignment:
| Q |
18 |
gaagaactattcatagcagtgtataaacttaattaaattatatgcaaatattgaatgatattccttttgataaagaaaactggcagaacacatctacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072152 |
gaagaactattcatagcagtgtgtaaaattaattaaattatatgcaaatattgaatgatattccttttgataaagaaaactggcagaacacatctacaaa |
46072251 |
T |
 |
| Q |
118 |
ataaaggaatctatacaaatttttcatctttatttacaatgaaaaatatggcagcttaacagaaaatatatctcccacttcagtatagaggctgagagtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46072252 |
ataaaggaatctatacaaatttttcatctttatttacaatgaaaaatatggcagcttaacagaaaa-----------------tatagaggctgagagtt |
46072334 |
T |
 |
| Q |
218 |
gatataccccagctgattcgaacacggtttaaaatacctaaagttgcatcttct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072335 |
gatataccccagctgattcgaacacggtttaaaatacctaaagttgcatcttct |
46072388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University