View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11839_high_8 (Length: 232)
Name: NF11839_high_8
Description: NF11839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11839_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 3284964 - 3284764
Alignment:
| Q |
13 |
caaaggaccaaagcgtgttgtcatcatccagaaagnnnnnnnncaccagctagagacatgtcccatgcttcatagttcacatatttgtccatggctgtgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284964 |
caaaggaccaaagcgtgttgtcatcatccagaaagaaaaaaaacaccagctagagacatgtcccatgcttcatagttcacatatttgtccatggctgtgg |
3284865 |
T |
 |
| Q |
113 |
agcaagaaatgataggaaagtacctgtgggattggatcaggtgtcagggaacctgaagagtttagcgaagcgcatttgagaagaaacttggagctcctgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3284864 |
agcaagaaatgataggaaagtacctgtgggattggatcaggtgtcagggaacctgaagagtttagcgacgcgcatttgagaagaaacttggagctcctgt |
3284765 |
T |
 |
| Q |
213 |
a |
213 |
Q |
| |
|
| |
|
|
| T |
3284764 |
a |
3284764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University