View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11839_low_2 (Length: 472)
Name: NF11839_low_2
Description: NF11839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11839_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 409; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 409; E-Value: 0
Query Start/End: Original strand, 18 - 462
Target Start/End: Original strand, 49017237 - 49017680
Alignment:
| Q |
18 |
ggatcagccgccagaatggcaggaacatcctccaaaattccagttgtgatcataagtgatgatgagatggcttacattgatgctgctttagcttttgcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49017237 |
ggatcagccgccagaatggcaggaacatcctccaaaattccagttgagatcataagtgatgatgagatggcttccattgatgctgctttagcttttgcag |
49017336 |
T |
 |
| Q |
118 |
cccgttctcttgtcactcctgctgcttctgttcctgctatacattcaccaatatcagcctcttggagtcgcagaatcggcacatcctttcagtcagttcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017337 |
cccgttctcttgtcactcctgctgcttctgttcctgccatacattcaccaatatcagcctcttggagtcgcagaatcggcacatcctttcagtcagttcc |
49017436 |
T |
 |
| Q |
218 |
agtgcgagccaagagaaggttattcccgtgttctgaacccgacatagaagatattggtagttgtgtaagtactaagaagaagaagaagtccagagcagat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49017437 |
agtgcgagccaagagaaggttattcccgtgttctgaacccgacatagaagatattggcagttttgt-agtactaagaagaagaagaagtccagagcagat |
49017535 |
T |
 |
| Q |
318 |
aacacgttactgcgccgatttaggagcaagaggggcttgtttgtcaccgatatcaccaaaacagaatggtgcgacaagcaaatggaattttcgctccttt |
417 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017536 |
aacacgttattgcaccgatttaggagcaagaggggcttgtttgtcaccgatatcaccaaaacagaatggtgcgacaagcaaatggaattttcgctccttt |
49017635 |
T |
 |
| Q |
418 |
ttgaagaatggaagaaccatgaagccaaaccggatttggcctttg |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49017636 |
ttgaagaatggaagaaccatgaagccaaaccggatttggcctttg |
49017680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University