View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11839_low_7 (Length: 286)

Name: NF11839_low_7
Description: NF11839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11839_low_7
NF11839_low_7
[»] chr3 (1 HSPs)
chr3 (18-271)||(46072152-46072388)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 46072152 - 46072388
Alignment:
18 gaagaactattcatagcagtgtataaacttaattaaattatatgcaaatattgaatgatattccttttgataaagaaaactggcagaacacatctacaaa 117  Q
    |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46072152 gaagaactattcatagcagtgtgtaaaattaattaaattatatgcaaatattgaatgatattccttttgataaagaaaactggcagaacacatctacaaa 46072251  T
118 ataaaggaatctatacaaatttttcatctttatttacaatgaaaaatatggcagcttaacagaaaatatatctcccacttcagtatagaggctgagagtt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 |||||||||||||||||    
46072252 ataaaggaatctatacaaatttttcatctttatttacaatgaaaaatatggcagcttaacagaaaa-----------------tatagaggctgagagtt 46072334  T
218 gatataccccagctgattcgaacacggtttaaaatacctaaagttgcatcttct 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46072335 gatataccccagctgattcgaacacggtttaaaatacctaaagttgcatcttct 46072388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University