View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11840_high_15 (Length: 241)
Name: NF11840_high_15
Description: NF11840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11840_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 32083997 - 32083779
Alignment:
| Q |
15 |
gcagagaatagggtcgagtttatagtaagattaccacacaaggctcgtaaaataaaattaaaattaaatatctttcttcagtcgcgccaccaccgagctc |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32083997 |
gcagcgaatagggtcgagtttatagtaagattaccacataaggctcgtaaaataaaattaaaatttaacatctttcttcagtcgcgccaccaccgagctc |
32083898 |
T |
 |
| Q |
115 |
gtttcgcaatagatttgcaagaacttggtacgagatcaaagtttgatgctctccagcccacatgtaacccattgatgatcagagaggtaatcccatccat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32083897 |
gtttcgcaatagatttgcaagaacttggtacgagatcaaagtttgatgctctccagcccacatgtaacccattgatgatcagagaggtaatcccatccat |
32083798 |
T |
 |
| Q |
215 |
tttattctttgatgtccat |
233 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
32083797 |
tttattctttgatgaccat |
32083779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University