View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11840_high_15 (Length: 241)

Name: NF11840_high_15
Description: NF11840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11840_high_15
NF11840_high_15
[»] chr3 (1 HSPs)
chr3 (15-233)||(32083779-32083997)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 233
Target Start/End: Complemental strand, 32083997 - 32083779
Alignment:
15 gcagagaatagggtcgagtttatagtaagattaccacacaaggctcgtaaaataaaattaaaattaaatatctttcttcagtcgcgccaccaccgagctc 114  Q
    |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
32083997 gcagcgaatagggtcgagtttatagtaagattaccacataaggctcgtaaaataaaattaaaatttaacatctttcttcagtcgcgccaccaccgagctc 32083898  T
115 gtttcgcaatagatttgcaagaacttggtacgagatcaaagtttgatgctctccagcccacatgtaacccattgatgatcagagaggtaatcccatccat 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32083897 gtttcgcaatagatttgcaagaacttggtacgagatcaaagtttgatgctctccagcccacatgtaacccattgatgatcagagaggtaatcccatccat 32083798  T
215 tttattctttgatgtccat 233  Q
    |||||||||||||| ||||    
32083797 tttattctttgatgaccat 32083779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University