View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11840_high_18 (Length: 209)
Name: NF11840_high_18
Description: NF11840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11840_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 83 - 193
Target Start/End: Complemental strand, 2571608 - 2571498
Alignment:
| Q |
83 |
atgaaaaggagaagggaaagtgaaggtgacatgnnnnnnnggaagtataatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2571608 |
atgaaaaggagaagggaaagtgaaggtgacatgtttttttggaagtttaatgaaaggtggtttgagtatgtgttattttgcttgtgggatgtgtttagga |
2571509 |
T |
 |
| Q |
183 |
ataatggtagt |
193 |
Q |
| |
|
||||||||||| |
|
|
| T |
2571508 |
ataatggtagt |
2571498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University