View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11840_low_19 (Length: 215)
Name: NF11840_low_19
Description: NF11840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11840_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 36683778 - 36683595
Alignment:
| Q |
16 |
agaccaacaatgcttgaagtttacaacaatttgagcaatacaagtaagtcacaatacctctctagtggtgattctaacccaaccggtggatcacaaattg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36683778 |
agaccaacaatgcttgaagtttacaacaatttgagcaatacaagtaagtcacaatacgtctctagtggtgattctaacccaaccggtggatcacaaattg |
36683679 |
T |
|
| Q |
116 |
cttctggtattctatagacgaaataaccgagttatnnnnnnnttagggcaggtttttgcatacataggctttgttgttattttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36683678 |
cttctggtattctatagacgaaataaccgagttataaaaaaattagggcaggtttttgcatacataggctttgttgctattttg |
36683595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 36673344 - 36673309
Alignment:
| Q |
19 |
ccaacaatgcttgaagtttacaacaatttgagcaat |
54 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36673344 |
ccaacaatgcttgaagtttacaacaatatgagcaat |
36673309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 54
Target Start/End: Complemental strand, 36695627 - 36695593
Alignment:
| Q |
20 |
caacaatgcttgaagtttacaacaatttgagcaat |
54 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
36695627 |
caacaatgcttgaagtttacaacaatatgagcaat |
36695593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University