View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_high_16 (Length: 300)
Name: NF11841_high_16
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 47055933 - 47055661
Alignment:
| Q |
18 |
atattttctatgagatttgtgcaatattgccgcaatccataatgaccgaaatcgtgatgaaatccttaacgcgcctcgaccgatatttaaacgttgcaaa |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47055933 |
atatttttgatgagatttgtgcaatattgccgatatccataatgaccaaaatcgtgatgaaatccttaacgcgcctcgaccgatatttaaacgtcgcaaa |
47055834 |
T |
|
| Q |
118 |
aaattctcnnnnnnntcccgataaaaggaataagggtgcaccgtcttaccaaagaacaagtgaatcctttcatattaacagcgtgtgttgtttacatgtt |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47055833 |
aaattctaaaaaaaatcccgataaaaggaataagggtgcaccgtcttaccaaagaacaagtgaatcctttcatattaacagcgtgtgttgtttacatgtt |
47055734 |
T |
|
| Q |
218 |
tggccaacacttcatgaattcggtgatagatagcaaatgaatttgtgaaactctctgaacttgaatgcctatg |
290 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47055733 |
tggccaacacttcatgaattcggagatagatagcaaatgaatttgtgaaactctctgaacttgaatgcctatg |
47055661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University