View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_high_18 (Length: 245)
Name: NF11841_high_18
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 76 - 229
Target Start/End: Complemental strand, 39588248 - 39588092
Alignment:
| Q |
76 |
tacttcttccaattcaatatataaaacaaagttaaaccaacaataattgatgtatcttatcataatttcatattaatattgatatgcgttaaaaaacata |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| | | |
|
|
| T |
39588248 |
tacttcttccaattcaatatataaaacaaagttaaaccaacaataactgatgtatcttatcataatttcatatcaatattgatatgggttaaaaaaaaaa |
39588149 |
T |
|
| Q |
176 |
at---tctctcattagccattgtaattgttgcagtgatcacatgttgccggctattg |
229 |
Q |
| |
|
| ||||||||||| |||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39588148 |
aaaaatctctcattagtcattataattgttgcagtgatcacattttgccggctattg |
39588092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 39590865 - 39590787
Alignment:
| Q |
1 |
ttaaatgacggctcacaaaagagaacatttctcaatttttatacaacgattttgataactttattatttggaagatact |
79 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39590865 |
ttaaatgacggttcacaagagagaacatttctcaatttttatacaacgattttgataactttattatttggaagatact |
39590787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University