View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_high_24 (Length: 241)
Name: NF11841_high_24
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38744351 - 38744574
Alignment:
| Q |
1 |
ctatttttctcataacaatgtgtccaatttcttcatcaatatcttgtgataatgtatattgggattttgtaacatgtatttggtaccttgcagcttatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38744351 |
ctatttttctcataacaatgtgtccaatttcttcatcaatatcttgtgataatgtatattgggattttgtaacatgtctttggtaccttgcagcttatga |
38744450 |
T |
|
| Q |
101 |
atccgaaccaacaacacgttgttgtaaaactgtagcaaaacaatatgaagaaagtatttgtgaatgtattgagaatttaggaaatgatttagatattcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38744451 |
atccgaaccaacaacacgttgttgtaaaactgtagcaaaacaatacgaagaaagtatttgtgaatgtattgagaatttgggaaatgatttagatattcgt |
38744550 |
T |
|
| Q |
201 |
tttgatatctctcgtattgatgat |
224 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
38744551 |
tttgatctctctcgtattgatgat |
38744574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University