View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_high_8 (Length: 366)
Name: NF11841_high_8
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 21 - 216
Target Start/End: Original strand, 10982880 - 10983075
Alignment:
| Q |
21 |
atcataagttgttttgttgtctcataaaataaaatttatgaataaaatggtgttgaaattgtgattcggataaattgggctcctttaatttatttgtttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982880 |
atcataagttgttttgttgtctcataaaataaaatttatgaataaaatggtggtgaaattgtgattcggataaattgggctcctttaatttatttgtttt |
10982979 |
T |
|
| Q |
121 |
tgtaataaataggtggtttaattcataaatatttgcacaattatccttttctacacaaattattttaaaagtgctcagcgatactatttctttatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982980 |
tgtaataaataggtggtttaattcataaatatttgcacaattatccttttccatacaaattattttaaaagtgctcagcgatactatttctttatg |
10983075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University