View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_10 (Length: 355)
Name: NF11841_low_10
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 3355074 - 3354943
Alignment:
| Q |
1 |
aaaaactcaaaagaaaaaggggactaaagatgtagatgggtatttctagatcnnnnnnnnnnntttagagataagttgaagtttctctcaccattaatat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3355074 |
aaaaactcaaaaggaaaaggggactaaagatgtagatgggtatttctaggtcaaaaaagaaagtttagagataagttggagtttctctcaccattaatat |
3354975 |
T |
|
| Q |
101 |
cttgttatttaatgaatgatcttatagcattc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3354974 |
cttgttatttaatgaatgatcttatagcattc |
3354943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 269 - 338
Target Start/End: Complemental strand, 3354840 - 3354771
Alignment:
| Q |
269 |
tttctcgtattattaccacgtaatgaacagttacataacaatcccccacctctccttactctctctctat |
338 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354840 |
tttctcgtattattaccacgtcatgaacagttacataacaatcccccacctctccttactctctctctat |
3354771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University