View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_13 (Length: 344)
Name: NF11841_low_13
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 10 - 332
Target Start/End: Original strand, 37749688 - 37750011
Alignment:
| Q |
10 |
gcatagatcgcagccgaactcttgattcattttaatgaaccacaacttcccctgaatcacatgattcacattctgctgtgggtgctgtcttgagacggcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37749688 |
gcatagatcgcagccgaactcttgattcattttaatgaaccacaacttcccctgaatcacatgattcacattctgctgcgggtgctgtcttgagacggcc |
37749787 |
T |
|
| Q |
110 |
atggtaagtcgacctggtttctaaaatgccaaagggttgtttttgcattcttgtttaaaagtgacagaatcattcgaaaataaacactctagaggaaccc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37749788 |
atggtaagtcgacctggtttctaaaatgccaaagggttgtttttgcattcttgtttaaaagtgacagaatcattcgaaaataaacactctagaggaaccc |
37749887 |
T |
|
| Q |
210 |
atgtcaaaatcaccattgaaaacaaacattctgctgcaggttctgcatttatgg-ttaccattccttcctactgtgcgtcttttttccatcctgcctaca |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37749888 |
atgtcaaaatcaccattgaaaacaaacattctgctgcgggttctgcatttatggtttaccattccttcctactgtgcgtcttttttccatcctgtctaca |
37749987 |
T |
|
| Q |
309 |
tggtgttttgctccctctctcctc |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37749988 |
tggtgttttgctccctctctcctc |
37750011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University