View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11841_low_21 (Length: 244)
Name: NF11841_low_21
Description: NF11841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11841_low_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 39480655 - 39480430
Alignment:
| Q |
19 |
atcagagacggtgtggacgttctatccttgtctctaggcggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggaga |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480655 |
atcagagatggtgtggacgttctatccttgtctctaggtggtttcccggtgccactatatgatgatagtattgccattggaagctttcgagcaatggaga |
39480556 |
T |
 |
| Q |
119 |
aagggatttcagttatatgtgcggcaggaaacaattgcccaatggcgatgtctgttgacaatgatgctccttggattgcaactattggagcaagcacact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39480555 |
aagggatttcagttatatgtgcggcaggaaacaatggcccaatggcgatgtctgttgccaatgatgctccttggattgcaactattggagcaagcacact |
39480456 |
T |
 |
| Q |
219 |
tgacagaaaattcccagctatagttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39480455 |
tgacagaaaattcccagctatagttc |
39480430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University